Difference between revisions of "Mpetredi Week 4"

From LMU BioDB 2013
Jump to: navigation, search
(Added notes about last command line string)
(added sig)
 
(10 intermediate revisions by one user not shown)
Line 1: Line 1:
 +
{{mpetredi}}
 +
 
# Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
 
# Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
#* -35 and -10 box of the promoter
+
#* -35 box of the promoter  
#** cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <\/minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box>/ <minus35box>&/g"
+
#**tttact
 +
#**sed -r "s/.{17} <minus10box>/ <\/minus35box> &/g" | sed "s/tt[gt]ac[at] <\/minus35box>/ <minus35box> &/g"
 +
#*-10 box of the promoter
 +
#**cattat
 +
#** cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g"
 
#* transcription start site
 
#* transcription start site
 +
#**atg
 
#**cat infA-E.coli-K12.txt | sed "2s/atg/<tss>&<\/tss> /1"
 
#**cat infA-E.coli-K12.txt | sed "2s/atg/<tss>&<\/tss> /1"
 
#* ribosome binding site  
 
#* ribosome binding site  
 +
#**gagg
 
#**cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs> /g"
 
#**cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs> /g"
 
#*start codon
 
#*start codon
 +
#**atg
 
#**cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
 
#**cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
 
#* stop codon
 
#* stop codon
#**cat infA-E.coli-K12.txt | sed "2s/t[ag][ag]/ <stop_codon>&<\/stop_codon> /2"  
+
#**tag
 +
#**cat infA-E.coli-K12.txt | sed "s/tag/ <stop_codon>&<\/stop_codon> /3" | sed "s/tga/ <stop_codon>&<\/stop_codon> /3" | sed "s/taa/ <stop_codon>&<\/stop_codon> /3"
 
#*terminator
 
#*terminator
 +
#**aaaaggtcggtttaaccggcctttttatt
 
#**cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
 
#**cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
 
# What is the ''exact'' mRNA sequence that is transcribed from this gene?
 
# What is the ''exact'' mRNA sequence that is transcribed from this gene?
 +
#*aaaagugguguucuuacuuacaaaagccguguaaagaggggucucacaauauuaacgccagcgucucaaccaaugcgaguaauggggcgacggcuauuccuuaaaaagcgcaguccauugcggguagcaaauagaguggcgagggaauaugcaacgcgaaaaccacgccgaaucggcacacaaaagccucauuacacggcuuggacaaacaacgcuaaaucgcgcguuuagaaaugaauaaaugucuugaagccguaauagaacggccaaguuuaaugccaucacuauggggucuccuaaucuaccgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcucauuuuccagccaaauuggccggaaaaauaaaaua
 
# What is the amino acid sequence that is translated from this mRNA?
 
# What is the amino acid sequence that is translated from this mRNA?
 +
#*Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F R S R Stop
  
NOTE: Answers not final
 
  
 
*All commands in one string
 
*All commands in one string
: cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <\/minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box>/ <minus35box>&/g" | sed "s/gagg/ <rbs>&<\/rbs> /g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | sed "2s/t[ag][ag]/ <stop_codon>&<\/stop_codon> /2" | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | sed "2s/atg/<tss>&<\/tss> /1"
+
cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <minus10box>/ <\/minus35box> &/g" | sed "s/tt[gt]ac[at] <\/minus35box>/ <minus35box> &/g" | sed "s/gagg/ <rbs>&<\/rbs> /g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | sed "s/.../ \n /3" | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | sed "2s/atg/<tss>&<\/tss> /1" | sed "s/tag/ <stop_codon>&<\/stop_codon> /3" | sed "s/tga/ <stop_codon>&<\/stop_codon> /3" | sed "s/taa/ <stop_codon>&<\/stop_codon> /3"
 +
 
 +
 
 +
[[User:Mpetredi|Mpetredi]] ([[User talk:Mpetredi|talk]]) 22:39, 19 September 2013 (PDT)Mitchell Petredis
  
:cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <\/minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box>/ <minus35box>&/g" | sed "2s/atg/<tss>&<\/tss> /1" | sed "s/gagg/ <rbs>&<\/rbs> /g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> \n /1" | sed "3s/.../ & /g" | sed "6s/tag|taa|tga/ <stop_codon>&<\/stop_codon> /2" | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
+
[[Category: Individual Homework]]
** Note: This splits everything after ATG into lines, but stop codon does not show and first two letters are separate from the other groups of 3s for some reason.
+
[[Category: Journal Entry]]

Latest revision as of 05:39, 20 September 2013

Mitchell Petredis (talk)mpetredi

[[Team Name]]

  1. Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
    • -35 box of the promoter
      • tttact
      • sed -r "s/.{17} <minus10box>/ <\/minus35box> &/g" | sed "s/tt[gt]ac[at] <\/minus35box>/ <minus35box> &/g"
    • -10 box of the promoter
      • cattat
      • cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g"
    • transcription start site
      • atg
      • cat infA-E.coli-K12.txt | sed "2s/atg/<tss>&<\/tss> /1"
    • ribosome binding site
      • gagg
      • cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs> /g"
    • start codon
      • atg
      • cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
    • stop codon
      • tag
      • cat infA-E.coli-K12.txt | sed "s/tag/ <stop_codon>&<\/stop_codon> /3" | sed "s/tga/ <stop_codon>&<\/stop_codon> /3" | sed "s/taa/ <stop_codon>&<\/stop_codon> /3"
    • terminator
      • aaaaggtcggtttaaccggcctttttatt
      • cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
  2. What is the exact mRNA sequence that is transcribed from this gene?
    • aaaagugguguucuuacuuacaaaagccguguaaagaggggucucacaauauuaacgccagcgucucaaccaaugcgaguaauggggcgacggcuauuccuuaaaaagcgcaguccauugcggguagcaaauagaguggcgagggaauaugcaacgcgaaaaccacgccgaaucggcacacaaaagccucauuacacggcuuggacaaacaacgcuaaaucgcgcguuuagaaaugaauaaaugucuugaagccguaauagaacggccaaguuuaaugccaucacuauggggucuccuaaucuaccgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcucauuuuccagccaaauuggccggaaaaauaaaaua
  3. What is the amino acid sequence that is translated from this mRNA?
    • Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F R S R Stop


  • All commands in one string

cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <minus10box>/ <\/minus35box> &/g" | sed "s/tt[gt]ac[at] <\/minus35box>/ <minus35box> &/g" | sed "s/gagg/ <rbs>&<\/rbs> /g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | sed "s/.../ \n /3" | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | sed "2s/atg/<tss>&<\/tss> /1" | sed "s/tag/ <stop_codon>&<\/stop_codon> /3" | sed "s/tga/ <stop_codon>&<\/stop_codon> /3" | sed "s/taa/ <stop_codon>&<\/stop_codon> /3"


Mpetredi (talk) 22:39, 19 September 2013 (PDT)Mitchell Petredis

Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox