Difference between revisions of "Mpetredi Week 4"

Latest revision as of 05:39, 20 September 2013

Mitchell Petredis (talk)mpetredi

[[Team Name]]

1. Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
   • -35 box of the promoter
     • tttact
     • sed -r "s/.{17} <minus10box>/ <\/minus35box> &/g" | sed "s/tt[gt]ac[at] <\/minus35box>/ <minus35box> &/g"
   • -10 box of the promoter
     • cattat
     • cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g"
   • transcription start site
     • atg
     • cat infA-E.coli-K12.txt | sed "2s/atg/<tss>&<\/tss> /1"
   • ribosome binding site
     • gagg
     • cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs> /g"
   • start codon
     • atg
     • cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
   • stop codon
     • tag
     • cat infA-E.coli-K12.txt | sed "s/tag/ <stop_codon>&<\/stop_codon> /3" | sed "s/tga/ <stop_codon>&<\/stop_codon> /3" | sed "s/taa/ <stop_codon>&<\/stop_codon> /3"
   • terminator
     • aaaaggtcggtttaaccggcctttttatt
     • cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
2. What is the exact mRNA sequence that is transcribed from this gene?
   • aaaagugguguucuuacuuacaaaagccguguaaagaggggucucacaauauuaacgccagcgucucaaccaaugcgaguaauggggcgacggcuauuccuuaaaaagcgcaguccauugcggguagcaaauagaguggcgagggaauaugcaacgcgaaaaccacgccgaaucggcacacaaaagccucauuacacggcuuggacaaacaacgcuaaaucgcgcguuuagaaaugaauaaaugucuugaagccguaauagaacggccaaguuuaaugccaucacuauggggucuccuaaucuaccgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcucauuuuccagccaaauuggccggaaaaauaaaaua
3. What is the amino acid sequence that is translated from this mRNA?
   • Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F R S R Stop

• All commands in one string

cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <minus10box>/ <\/minus35box> &/g" | sed "s/tt[gt]ac[at] <\/minus35box>/ <minus35box> &/g" | sed "s/gagg/ <rbs>&<\/rbs> /g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | sed "s/.../ \n /3" | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | sed "2s/atg/<tss>&<\/tss> /1" | sed "s/tag/ <stop_codon>&<\/stop_codon> /3" | sed "s/tga/ <stop_codon>&<\/stop_codon> /3" | sed "s/taa/ <stop_codon>&<\/stop_codon> /3"

Mpetredi (talk) 22:39, 19 September 2013 (PDT)Mitchell Petredis