Difference between revisions of "Ksherbina Week 4"
From LMU BioDB 2013
(→Transcription and Translation "Taken to the Next Level": Changed code in question 2 and question 3.) |
(→Transcription and Translation "Taken to the Next Level": Added how the sequence for the infA gene looks like with tags.) |
||
| Line 3: | Line 3: | ||
==Transcription and Translation "Taken to the Next Level"== | ==Transcription and Translation "Taken to the Next Level"== | ||
| − | 1. The piped sequence of text to tag the ''infA'' gene in ''E. coli'' K12: | + | 1.(a) The ''infA'' gene in ''E. coli'' K12 with all the tags looks like the following: |
| + | ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctca | ||
| + | ccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact</minus35box> | ||
| + | tatttacagaacttcgg <minus10box>cattat</minus10box> cttgc <tss>c</tss> ggttcaaattacggtagtgatacccca <rbs>gagg</rbs> | ||
| + | attag <start_codon>atg</start_codon> | ||
| + | gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcat | ||
| + | cctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgc <stop_codon>tga</stop_codon> | ||
| + | ttgttttaccgcctgatgggcgaagagaaagaacgagt <terminator>aaaaggtcggtttaaccggcctttt</terminator> tattttat | ||
| + | |||
| + | :(b) The piped sequence of text to tag the ''infA'' gene in ''E. coli'' K12: | ||
cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | | cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | | ||
sed -r "s/.{17} <minus10box/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>&/g" | | sed -r "s/.{17} <minus10box/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>&/g" | | ||
Revision as of 06:34, 20 September 2013
| Assignment Description | Week 1 | Week 2 | Week 3 | Week 4 | Week 5 | Week 6 | Week 7 | Week 8 | Week 9 | Week 10 | Week 11 | Week 12 | Week 13 | Week 15 |
| Class Journal | Week 1 | Week 2 | Week 3 | Week 4 | Week 5 | Week 6 | Week 7 | Week 8 | Week 9 | |||||
| Individual Journal | Week 2 | Week 3 | Week 4 | Week 5 | Week 6 | Week 7 | Week 8 | Week 9 | Week 10 | Week 11 |
| Other | Week 5: Database Wiki |
| Final Project | Team H(oo)KD Project Page | Journal Club Presentation | Project Individual Journal |
Transcription and Translation "Taken to the Next Level"
1.(a) The infA gene in E. coli K12 with all the tags looks like the following:
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctca ccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact</minus35box> tatttacagaacttcgg <minus10box>cattat</minus10box> cttgc <tss>c</tss> ggttcaaattacggtagtgatacccca <rbs>gagg</rbs> attag <start_codon>atg</start_codon> gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcat cctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgc <stop_codon>tga</stop_codon> ttgttttaccgcctgatgggcgaagagaaagaacgagt <terminator>aaaaggtcggtttaaccggcctttt</terminator> tattttat
- (b) The piped sequence of text to tag the infA gene in E. coli K12:
cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" |
sed -r "s/.{17} <minus10box/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>&/g" |
sed -r "s/\/minus10box> .{6}/&<\/tss> /g" | sed "s/.<\/tss> / <tss>&/g" | sed "s/gagg/ <rbs>&<\/rbs>/g" |
sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" |
sed -r "2s/<\/start_codon> .{3}*t[ag][ag]/&<\/stop_codon> /g" | sed "s/...<\/stop_codon> / <stop_codon>&/g" |
sed "2s/aaaaggt/ <terminator>&/g" | sed "2s/gcctttt/&<\/terminator> /g"
2. The mRNA sequence that is transcribed from this gene can be determined using the following piped sequence of text:
cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" |
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" | grep "aug" | sed "s/.../& /g"
3. The amino acid sequence that is translated from the mRNA sequence can be determined using the following piped sequence of text:
cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" |
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" | grep "^aug" | sed "s/.../& /g" | sed -f genetic-code.sed
