Difference between revisions of "Ksherbina Week 4"

Revision as of 06:38, 20 September 2013

Transcription and Translation "Taken to the Next Level"

1.(a) The infA gene in E. coli K12 with all the tags looks like the following:

ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctca
ccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact</minus35box> 
tatttacagaacttcgg <minus10box>cattat</minus10box> cttgc <tss>c</tss> ggttcaaattacggtagtgatacccca <rbs>gagg</rbs>
attag <start_codon>atg</start_codon> 
gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcat
cctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgc <stop_codon>tga</stop_codon> 
ttgttttaccgcctgatgggcgaagagaaagaacgagt <terminator>aaaaggtcggtttaaccggcctttt</terminator> tattttat

(b) The piped sequence of text to tag the infA gene in E. coli K12:

cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | 
sed -r "s/.{17} <minus10box/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>&/g" | 
sed -r "s/\/minus10box> .{6}/&<\/tss> /g" | sed "s/.<\/tss> / <tss>&/g" | sed "s/gagg/ <rbs>&<\/rbs>/g" | 
sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | 
sed -r "2s/<\/start_codon> .{3}*t[ag][ag]/&<\/stop_codon> /g" | sed "s/...<\/stop_codon> / <stop_codon>&/g" | 
sed "2s/aaaaggt/ <terminator>&/g" | sed "2s/gcctttt/&<\/terminator> /g"

2.(a) The mRNA sequence that is transcribed from the infA gene (codons are designated) is

aug gcc aaa gaa gac aau auu gaa aug caa ggu acc guu cuu gaa acg uug ccu aau acc aug uuc cgc gua gag uua gaa aac ggu cac gug guu acu gca  
cac auc ucc ggu aaa aug cgc aaa aac uac auc cgc auc cug acg ggc gac aaa gug acu guu gaa cug acc ccg uac gac cug agc aaa ggc cgc auu guc 
uuc cgu agu cgc uga

(b) The mRNA sequence that is transcribed from this gene can be determined using the following piped sequence of text:

cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" | 
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" | grep "aug" | sed "s/.../& /g"

3. (a) The amino acid sequence that is translated from the mRNA sequence is

M A K E D N I E M Q G T V L E T L P N T M F R V E L E N G H V V T A H I S G K M R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F  
R S R -

(b) The amino acid sequence that is translated from the mRNA sequence can be determined using the following piped sequence of text:

cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" | 
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" |  grep "^aug" | sed "s/.../& /g" | sed -f genetic-code.sed