#**cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
 
#**cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
 
#* stop codon (*Note: not final answer)
 
#* stop codon (*Note: not final answer)
#**cat infA-E.coli-K12.txt | sed "2s/t[ag][ag]/ <stop_codon>&<\/stop_codon> /2"  
+
#**cat infA-E.coli-K12.txt | sed "s/tga/ <stop_codon>&<\/stop_codon> /7"  
 
#*terminator
 
#*terminator
 
#**cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
 
#**cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
 
# What is the ''exact'' mRNA sequence that is transcribed from this gene?
 
# What is the ''exact'' mRNA sequence that is transcribed from this gene?
 +
#*cgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcugg
 
# What is the amino acid sequence that is translated from this mRNA?
 
# What is the amino acid sequence that is translated from this mRNA?
#*The amino acid sequence is Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F R S R Stop
+
#*The amino acid sequence is Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L
       
*All commands in one string
 
*All commands in one string
Unexpected non-MediaWiki exception encountered, of type "Error"
Error: Call to undefined function each() in /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php:374
Stack trace:
#0 /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php(480): _DiffEngine->_diag()
#1 /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php(291): _DiffEngine->_compareseq()
#2 /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php(175): _DiffEngine->diff_local()
#3 /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php(653): _DiffEngine->diff()
#4 /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php(820): Diff->__construct()
#5 /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php(1240): MappedDiff->__construct()
#6 /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php(1458): WordLevelDiff->__construct()
#7 /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php(952): TableDiffFormatter->_changed()
#8 /apps/xmlpipedb/biodb/fall2013/includes/diff/DairikiDiff.php(924): DiffFormatter->_block()
#9 /apps/xmlpipedb/biodb/fall2013/includes/diff/DifferenceEngine.php(765): DiffFormatter->format()
#10 /apps/xmlpipedb/biodb/fall2013/includes/diff/DifferenceEngine.php(655): DifferenceEngine->generateDiffBody()
#11 /apps/xmlpipedb/biodb/fall2013/includes/diff/DifferenceEngine.php(593): DifferenceEngine->getDiffBody()
#12 /apps/xmlpipedb/biodb/fall2013/includes/diff/DifferenceEngine.php(566): DifferenceEngine->getDiff()
#13 /apps/xmlpipedb/biodb/fall2013/includes/diff/DifferenceEngine.php(409): DifferenceEngine->showDiff()
#14 /apps/xmlpipedb/biodb/fall2013/includes/Article.php(725): DifferenceEngine->showDiffPage()
#15 /apps/xmlpipedb/biodb/fall2013/includes/Article.php(478): Article->showDiffPage()
#16 /apps/xmlpipedb/biodb/fall2013/includes/actions/ViewAction.php(37): Article->view()
#17 /apps/xmlpipedb/biodb/fall2013/includes/Wiki.php(427): ViewAction->show()
#18 /apps/xmlpipedb/biodb/fall2013/includes/Wiki.php(304): MediaWiki->performAction()
#19 /apps/xmlpipedb/biodb/fall2013/includes/Wiki.php(536): MediaWiki->performRequest()
#20 /apps/xmlpipedb/biodb/fall2013/includes/Wiki.php(446): MediaWiki->main()
#21 /apps/xmlpipedb/biodb/fall2013/index.php(59): MediaWiki->run()
#22 {main}