Difference between revisions of "Ksherbina Week 4"

From LMU BioDB 2013
Jump to: navigation, search
(Modified the part of the piped sequence of text that tag this stop codon. Added to the pipe sequence of text commands to find the transcription start site and the terminator.)
(→‎Transcription and Translation "Taken to the Next Level": Added comments regarding another way to write the code for to determine the amino acid sequence corresponding to the mRNA sequence.)
 
(13 intermediate revisions by one user not shown)
Line 3: Line 3:
 
==Transcription and Translation "Taken to the Next Level"==
 
==Transcription and Translation "Taken to the Next Level"==
  
−
#The piped sequence of text to tag the ''infA'' gene in ''E. coli'' K12:
+
1.(a) The ''infA'' gene in ''E. coli'' K12 with all the tags looks like the following:
 +
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctca
 +
ccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact</minus35box>
 +
tatttacagaacttcgg <minus10box>cattat</minus10box> cttgc <tss>c</tss> ggttcaaattacggtagtgatacccca <rbs>gagg</rbs>
 +
attag <start_codon>atg</start_codon>
 +
gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcat
 +
cctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgc <stop_codon>tga</stop_codon>
 +
ttgttttaccgcctgatgggcgaagagaaagaacgagt <terminator>aaaaggtcggtttaaccggcctttt</terminator> tattttat
 +
 
 +
:(b) The piped sequence of text to tag the ''infA'' gene in ''E. coli'' K12:
 +
cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" |
 +
sed -r "s/.{17} <minus10box/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>&/g" |
 +
sed -r "s/\/minus10box> .{6}/&<\/tss> /g" | sed "s/.<\/tss> / <tss>&/g" | sed "s/gagg/ <rbs>&<\/rbs>/g" |
 +
sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" |
 +
sed -r "2s/<\/start_codon> .{3}*t[ag][ag]/&<\/stop_codon> /g" | sed "s/...<\/stop_codon> / <stop_codon>&/g" |
 +
sed "2s/aaaaggt/ <terminator>&/g" | sed "2s/gcctttt/&<\/terminator> /g"
 +
 
 +
<!-- Corrections -->
 +
<!-- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | -->
 +
<!-- sed -r "s/.{17} <minus10box/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>&/g" | -->
 +
<!-- sed -r "s/\/minus10box> .{7}/&<\/tss> /g" | sed "s/.<\/tss> / <tss>&/g" | sed "s/gagg/ <rbs>&<\/rbs>/g" | -->
 +
<!-- sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | -->
 +
<!-- sed -r "2s/<\/start_codon> .{3}*t[ag][ag]/&<\/stop_codon> /g" | sed "s/...<\/stop_codon> / <stop_codon>&/g" | -->
 +
<!-- sed "2s/aaaaggt/ <terminator>&/g" | sed "2s/gcctttt..../&<\/terminator> /g" -->
 +
 
 +
2.(a) The mRNA sequence that is transcribed from the ''infA'' gene (codons are designated) is
 +
aug gcc aaa gaa gac aau auu gaa aug caa ggu acc guu cuu gaa acg uug ccu aau acc aug uuc cgc gua gag uua gaa aac ggu cac gug guu acu gca 
 +
cac auc ucc ggu aaa aug cgc aaa aac uac auc cgc auc cug acg ggc gac aaa gug acu guu gaa cug acc ccg uac gac cug agc aaa ggc cgc auu guc
 +
uuc cgu agu cgc uga
 +
 
 +
[[Category:Journal Entry]]
 +
 
 +
:(b) The mRNA sequence that is transcribed from this gene can be determined using the following piped sequence of text:
 +
cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" |
 +
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" | grep "aug" | sed "s/.../& /g"
 +
 
 +
<!-- Corrections -->
 +
<!-- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/\/minus10box> .{6}/& <tss>/g" | -->
 +
<!-- sed "s/tss>/&\n/g" | sed "2s/gcctttt..../&\n/g" | sed "1D" | sed "2D" -->
 +
:<!-- Could not get the command sed "1,3D" to work. From the output, it looked as if everything was deleted. -->
 +
 
 +
3. (a) The amino acid sequence that is translated from the mRNA sequence is
 +
M A K E D N I E M Q G T V L E T L P N T M F R V E L E N G H V V T A H I S G K M R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F 
 +
R S R -
 +
 
 +
:(b) The amino acid sequence that is translated from the mRNA sequence can be determined using the following piped sequence of text:
 +
cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" |
 +
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" |  grep "^aug" | sed "s/.../& /g" | sed -f genetic-code.sed
 +
 
 +
<!-- Alternate way to write the code for #3 to determine the amino acid sequence by extending the corrected code for #2 -->
 +
<!-- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/\/minus10box> .{6}/& <tss>/g" | -->
 +
<!-- sed "s/tss>/&\n/g" | sed "2s/gcctttt..../&\n/g" | sed "1D" | sed "2D" | sed "s/gagg/&\n/g" | sed "2s/atg/\n&/1" | -->
 +
<!-- sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" |  grep "^aug" | sed "s/.../& /g" | sed -f genetic-code.sed -->
  
−
cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <minus10box/<\/minus35b    ox> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>&/g" | sed -r "s/\/minus10box> .{6}/&<\/tss> /g" | sed "s/.<\/tss> / <tss>&/g" | sed "s/gagg/ <rbs>&<\/rb    s>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | sed -r "2s/<\/start_codon> .{3}*t[ag][ag]/&<\/stop_codon> /g" | sed "s/...<\/stop_c    odon> / <stop_codon>&/g" | sed "2s/aaaaggt/ <terminator>&/g" | sed "2s/gcctttt/&<\/terminator> /g"
 
  
 
<!-- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>& /g" | sed "s/gagg/<rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n /g" | sed "2s/atg/&<\/START>/1"
 
<!-- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>& /g" | sed "s/gagg/<rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n /g" | sed "2s/atg/&<\/START>/1"

Latest revision as of 07:12, 25 September 2013

Katrina Sherbina
Class Page    User Page
Assignment Description Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 15
Class Journal Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9
Individual Journal Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11
Other Week 5: Database Wiki
Final Project Team H(oo)KD Project Page Journal Club Presentation Project Individual Journal

[edit] Transcription and Translation "Taken to the Next Level"

1.(a) The infA gene in E. coli K12 with all the tags looks like the following: 

ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctca
ccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact</minus35box> 
tatttacagaacttcgg <minus10box>cattat</minus10box> cttgc <tss>c</tss> ggttcaaattacggtagtgatacccca <rbs>gagg</rbs>
attag <start_codon>atg</start_codon> 
gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcat
cctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgc <stop_codon>tga</stop_codon> 
ttgttttaccgcctgatgggcgaagagaaagaacgagt <terminator>aaaaggtcggtttaaccggcctttt</terminator> tattttat
(b) The piped sequence of text to tag the infA gene in E. coli K12: 
cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | 
sed -r "s/.{17} <minus10box/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>&/g" | 
sed -r "s/\/minus10box> .{6}/&<\/tss> /g" | sed "s/.<\/tss> / <tss>&/g" | sed "s/gagg/ <rbs>&<\/rbs>/g" | 
sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | 
sed -r "2s/<\/start_codon> .{3}*t[ag][ag]/&<\/stop_codon> /g" | sed "s/...<\/stop_codon> / <stop_codon>&/g" | 
sed "2s/aaaaggt/ <terminator>&/g" | sed "2s/gcctttt/&<\/terminator> /g"


2.(a) The mRNA sequence that is transcribed from the infA gene (codons are designated) is 

aug gcc aaa gaa gac aau auu gaa aug caa ggu acc guu cuu gaa acg uug ccu aau acc aug uuc cgc gua gag uua gaa aac ggu cac gug guu acu gca  
cac auc ucc ggu aaa aug cgc aaa aac uac auc cgc auc cug acg ggc gac aaa gug acu guu gaa cug acc ccg uac gac cug agc aaa ggc cgc auu guc 
uuc cgu agu cgc uga
(b) The mRNA sequence that is transcribed from this gene can be determined using the following piped sequence of text: 
cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" | 
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" | grep "aug" | sed "s/.../& /g"

3. (a) The amino acid sequence that is translated from the mRNA sequence is 

M A K E D N I E M Q G T V L E T L P N T M F R V E L E N G H V V T A H I S G K M R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F  
R S R -
(b) The amino acid sequence that is translated from the mRNA sequence can be determined using the following piped sequence of text: 
cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" | 
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" |  grep "^aug" | sed "s/.../& /g" | sed -f genetic-code.sed


Retrieved from "https://xmlpipedb.lmucs.io/biodb/fall2013/index.php?title=Ksherbina_Week_4&oldid=2076"
Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox