Difference between revisions of "Lena Week 4"
From LMU BioDB 2013
(edited amino acids) |
(mRNA) |
||
| Line 13: | Line 13: | ||
#**cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | #**cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | ||
# What is the ''exact'' mRNA sequence that is transcribed from this gene? | # What is the ''exact'' mRNA sequence that is transcribed from this gene? | ||
| + | #*cgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguagg | ||
# What is the amino acid sequence that is translated from this mRNA? | # What is the amino acid sequence that is translated from this mRNA? | ||
#*The amino acid sequence is Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F R S R Stop | #*The amino acid sequence is Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F R S R Stop | ||
Revision as of 04:26, 20 September 2013
- Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
- -35 and -10 box of the promoter
- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <\/minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box>/ <minus35box>&/g"
- transcription start site
- cat infA-E.coli-K12.txt | sed "2s/atg/<tss>&<\/tss> /1"
- ribosome binding site
- cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs> /g"
- start codon
- cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
- stop codon (*Note: not final answer)
- cat infA-E.coli-K12.txt | sed "2s/t[ag][ag]/ <stop_codon>&<\/stop_codon> /2"
- terminator
- cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
- -35 and -10 box of the promoter
- What is the exact mRNA sequence that is transcribed from this gene?
- cgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguagg
- What is the amino acid sequence that is translated from this mRNA?
- The amino acid sequence is Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F R S R Stop
- All commands in one string
- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <\/minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box>/ <minus35box>&/g" | sed "s/gagg/ <rbs>&<\/rbs> /g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | sed "s/t[ag][ag]/ <stop>&<\/stop> /3" | sed "s/.../ \n /3" | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | sed "2s/atg/<tss>&<\/tss> /1"
