Difference between revisions of "Lena Week 4"
From LMU BioDB 2013
(all commands) |
|||
| Line 9: | Line 9: | ||
#**cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g" | #**cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g" | ||
#* stop codon (*Note: not final answer) | #* stop codon (*Note: not final answer) | ||
| − | #**cat infA-E.coli-K12.txt | sed " | + | #**cat infA-E.coli-K12.txt | sed "s/tga/ <stop_codon>&<\/stop_codon> /7" |
#*terminator | #*terminator | ||
#**cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | #**cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | ||
Latest revision as of 04:35, 20 September 2013
- Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
- -35 and -10 box of the promoter
- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <\/minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box>/ <minus35box>&/g"
- transcription start site
- cat infA-E.coli-K12.txt | sed "2s/atg/<tss>&<\/tss> /1"
- ribosome binding site
- cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs> /g"
- start codon
- cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
- stop codon (*Note: not final answer)
- cat infA-E.coli-K12.txt | sed "s/tga/ <stop_codon>&<\/stop_codon> /7"
- terminator
- cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
- -35 and -10 box of the promoter
- What is the exact mRNA sequence that is transcribed from this gene?
- cgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcugg
- What is the amino acid sequence that is translated from this mRNA?
- The amino acid sequence is Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L
- All commands in one string
- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <\/minus10/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box>/ <minus35box>&/g" | sed "s/gagg/ <rbs>&<\/rbs> /g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | sed "s/.../ \n /3" | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | sed "2s/atg/<tss>&<\/tss> /1" | sed "s/tga/ <stop>&<\/stop> /7" | sed "y/atcg/uagc/"