Difference between revisions of "Ksherbina Week 4"
From LMU BioDB 2013
(→Transcription and Translation "Taken to the Next Level": Used commenting to record corrections to the code for #1 based on the feedback given by Dondi.) |
(→Transcription and Translation "Taken to the Next Level": Added comment that describes the how to correct the code in #2 to take into account Dondi's feedback.) |
||
| Line 27: | Line 27: | ||
<!-- sed -r "2s/<\/start_codon> .{3}*t[ag][ag]/&<\/stop_codon> /g" | sed "s/...<\/stop_codon> / <stop_codon>&/g" | --> | <!-- sed -r "2s/<\/start_codon> .{3}*t[ag][ag]/&<\/stop_codon> /g" | sed "s/...<\/stop_codon> / <stop_codon>&/g" | --> | ||
<!-- sed "2s/aaaaggt/ <terminator>&/g" | sed "2s/gcctttt..../&<\/terminator> /g" --> | <!-- sed "2s/aaaaggt/ <terminator>&/g" | sed "2s/gcctttt..../&<\/terminator> /g" --> | ||
| − | |||
2.(a) The mRNA sequence that is transcribed from the ''infA'' gene (codons are designated) is | 2.(a) The mRNA sequence that is transcribed from the ''infA'' gene (codons are designated) is | ||
| Line 39: | Line 38: | ||
cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" | | cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" | | ||
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" | grep "aug" | sed "s/.../& /g" | sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" | grep "aug" | sed "s/.../& /g" | ||
| + | |||
| + | <!-- Corrections --> | ||
| + | <!-- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/\/minus10box> .{6}/& <tss>/g" | --> | ||
| + | <!-- sed "s/tss>/&\n/g" | sed "2s/gcctttt..../&\n/g" | sed "1D" | sed "2D" --> | ||
| + | :<!-- Could not get the command sed "1,3D" to work. From the output, it looked as if everything was deleted. --> | ||
3. (a) The amino acid sequence that is translated from the mRNA sequence is | 3. (a) The amino acid sequence that is translated from the mRNA sequence is | ||
Revision as of 07:04, 25 September 2013
| Assignment Description | Week 1 | Week 2 | Week 3 | Week 4 | Week 5 | Week 6 | Week 7 | Week 8 | Week 9 | Week 10 | Week 11 | Week 12 | Week 13 | Week 15 |
| Class Journal | Week 1 | Week 2 | Week 3 | Week 4 | Week 5 | Week 6 | Week 7 | Week 8 | Week 9 | |||||
| Individual Journal | Week 2 | Week 3 | Week 4 | Week 5 | Week 6 | Week 7 | Week 8 | Week 9 | Week 10 | Week 11 |
| Other | Week 5: Database Wiki |
| Final Project | Team H(oo)KD Project Page | Journal Club Presentation | Project Individual Journal |
Transcription and Translation "Taken to the Next Level"
1.(a) The infA gene in E. coli K12 with all the tags looks like the following:
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctca ccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact</minus35box> tatttacagaacttcgg <minus10box>cattat</minus10box> cttgc <tss>c</tss> ggttcaaattacggtagtgatacccca <rbs>gagg</rbs> attag <start_codon>atg</start_codon> gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcat cctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgc <stop_codon>tga</stop_codon> ttgttttaccgcctgatgggcgaagagaaagaacgagt <terminator>aaaaggtcggtttaaccggcctttt</terminator> tattttat
- (b) The piped sequence of text to tag the infA gene in E. coli K12:
cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" |
sed -r "s/.{17} <minus10box/<\/minus35box> &/g" | sed "s/tt[gt]ac[at]<\/minus35box> / <minus35box>&/g" |
sed -r "s/\/minus10box> .{6}/&<\/tss> /g" | sed "s/.<\/tss> / <tss>&/g" | sed "s/gagg/ <rbs>&<\/rbs>/g" |
sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" |
sed -r "2s/<\/start_codon> .{3}*t[ag][ag]/&<\/stop_codon> /g" | sed "s/...<\/stop_codon> / <stop_codon>&/g" |
sed "2s/aaaaggt/ <terminator>&/g" | sed "2s/gcctttt/&<\/terminator> /g"
2.(a) The mRNA sequence that is transcribed from the infA gene (codons are designated) is
aug gcc aaa gaa gac aau auu gaa aug caa ggu acc guu cuu gaa acg uug ccu aau acc aug uuc cgc gua gag uua gaa aac ggu cac gug guu acu gca cac auc ucc ggu aaa aug cgc aaa aac uac auc cgc auc cug acg ggc gac aaa gug acu guu gaa cug acc ccg uac gac cug agc aaa ggc cgc auu guc uuc cgu agu cgc uga
- (b) The mRNA sequence that is transcribed from this gene can be determined using the following piped sequence of text:
cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" |
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" | grep "aug" | sed "s/.../& /g"
3. (a) The amino acid sequence that is translated from the mRNA sequence is
M A K E D N I E M Q G T V L E T L P N T M F R V E L E N G H V V T A H I S G K M R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F R S R -
- (b) The amino acid sequence that is translated from the mRNA sequence can be determined using the following piped sequence of text:
cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs>/g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/\n&/1" |
sed -r "3s/^.{3}*t[ag][ag]/&\n/g" | sed "3s/t/u/g" | grep "^aug" | sed "s/.../& /g" | sed -f genetic-code.sed
