Difference between revisions of "Mpetredi Week 4"
From LMU BioDB 2013
(added categories) |
(added link to my user page) |
||
| Line 1: | Line 1: | ||
| + | {{mpetredi}} | ||
| + | |||
# Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag): | # Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag): | ||
#* -35 box of the promoter | #* -35 box of the promoter | ||
Revision as of 05:18, 20 September 2013
Mitchell Petredis (talk)mpetredi
[[Team Name]]
- Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
- -35 box of the promoter
- tttact
- sed -r "s/.{17} <minus10box>/ <\/minus35box> &/g" | sed "s/tt[gt]ac[at] <\/minus35box>/ <minus35box> &/g"
- -10 box of the promoter
- cattat
- cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g"
- transcription start site
- atg
- cat infA-E.coli-K12.txt | sed "2s/atg/<tss>&<\/tss> /1"
- ribosome binding site
- gagg
- cat infA-E.coli-K12.txt | sed "s/gagg/ <rbs>&<\/rbs> /g"
- start codon
- atg
- cat infA-E.coli-K12.txt | sed "2s/atg/ <start_codon>&<\/start_codon> /g"
- stop codon
- tag
- cat infA-E.coli-K12.txt | sed "s/tag/ <stop_codon>&<\/stop_codon> /3" | sed "s/tga/ <stop_codon>&<\/stop_codon> /3" | sed "s/taa/ <stop_codon>&<\/stop_codon> /3"
- terminator
- aaaaggtcggtttaaccggcctttttatt
- cat infA-E.coli-K12.txt | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g"
- -35 box of the promoter
- What is the exact mRNA sequence that is transcribed from this gene?
- aaaagugguguucuuacuuacaaaagccguguaaagaggggucucacaauauuaacgccagcgucucaaccaaugcgaguaauggggcgacggcuauuccuuaaaaagcgcaguccauugcggguagcaaauagaguggcgagggaauaugcaacgcgaaaaccacgccgaaucggcacacaaaagccucauuacacggcuuggacaaacaacgcuaaaucgcgcguuuagaaaugaauaaaugucuugaagccguaauagaacggccaaguuuaaugccaucacuauggggucuccuaaucuaccgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcucauuuuccagccaaauuggccggaaaaauaaaaua
- What is the amino acid sequence that is translated from this mRNA?
- Met A K E D N I E Met Q G T V L E T L P N T Met F R V E L E N G H V V T A H I S G K Met R K N Y I R I L T G D K V T V E L T P Y D L S K G R I V F R S R Stop
- All commands in one string
cat infA-E.coli-K12.txt | sed "s/cat[at]at/ <minus10box>&<\/minus10box> /g" | sed -r "s/.{17} <minus10box>/ <\/minus35box> &/g" | sed "s/tt[gt]ac[at] <\/minus35box>/ <minus35box> &/g" | sed "s/gagg/ <rbs>&<\/rbs> /g" | sed "s/<\/rbs>/&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1" | sed "s/.../ \n /3" | sed "s/aaaaggt...........gcctttt..../ <terminator>&<\/terminator> /g" | sed "2s/atg/<tss>&<\/tss> /1" | sed "s/tag/ <stop_codon>&<\/stop_codon> /3" | sed "s/tga/ <stop_codon>&<\/stop_codon> /3" | sed "s/taa/ <stop_codon>&<\/stop_codon> /3"
