View source for Kevin Wyllie Week 2

=== Journal Week 2 ===

The given DNA sequence is written in the top strand, while its complementary strand is shown below it.


 5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3'
 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaa t- 5'


Translated reading frames:
* '''+1'''  Nter-R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-Cter '''(This is an open reading frame.)'''
* '''+2'''  Nter-V-C-Cter
* '''+3'''  Nter-Y-A-N-T-M-F-R-V-Cter
* '''-1'''  The first codon in this reading frame is a STOP codon, so there is no polypeptide.
* '''-2'''  Nter-K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I-Cter '''(This is an open reading frame.)'''
* '''-3'''  Nter-K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y-Cter '''(This is an open reading frame.)'''


[[Category:Journal Entry]]


* [[User:Kwyllie]]