https://xmlpipedb.lmucs.io/biodb/fall2015/index.php?action=history&feed=atom&title=Blitvak_Week_3Blitvak Week 3 - Revision history2026-06-07T08:03:49ZRevision history for this page on the wikiMediaWiki 1.25.1https://xmlpipedb.lmucs.io/biodb/fall2015/index.php?title=Blitvak_Week_3&diff=1549&oldid=prevBlitvak: added ExPASy outputs2015-09-22T03:57:52Z<p>added ExPASy outputs</p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 03:57, 22 September 2015</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L61" >Line 61:</td>
<td colspan="2" class="diff-lineno">Line 61:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Checking Results ====</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Checking Results ====</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>*Using the [http://web.expasy.org/translate/ ExPASy Translate Tool], <code>tctactatatttcaataggtacgatggccaaagaagacaatattgaacttgaaacgttgcctaataccatgttccgcgtataacccagccgccagttccgctggcggcattttaac</code> was entered and converted into the possible sequences of amino acids (output format was selected as compact). The 6 reading frames, as given by this tool, matched those found in the assignment</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*Using the [http://web.expasy.org/translate/ ExPASy Translate Tool], <code>tctactatatttcaataggtacgatggccaaagaagacaatattgaacttgaaacgttgcctaataccatgttccgcgtataacccagccgccagttccgctggcggcattttaac</code> was entered and converted into the possible sequences of amino acids (output format was selected as compact). The 6 reading frames, as <ins class="diffchange diffchange-inline">[[Media:ExPASy_Translate_Tool_Results.txt |</ins>given<ins class="diffchange diffchange-inline">]] </ins>by this tool, matched those found in the assignment</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===XMLPipeDB Match Practice===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===XMLPipeDB Match Practice===</div></td></tr>
</table>Blitvak
*''prokaryote.txt'' in ''~dondi/xmlpipedb/data'' was examined using <code>cat prokaryote.txt</code>
*''prokaryote.txt'' in ''~dondi/xmlpipedb/data'' was examined using <code>cat prokaryote.txt</code>
*''prokaryote.txt'' was chosen for use in the first part of this assignment
*''prokaryote.txt'' was chosen for use in the first part of this assignment
−
*The sequence in ''prokaryote.txt'' was copied and pasted on a separate file for future reference and checking
+
*The sequence in ''prokaryote.txt'' was copied and pasted on a separate file for future reference and checking (additionally, I found that text can be copied by highlighting and right-clicking)
+
*Key goal in this first segment is to find the complementary strand of the sequence in ''prokaryote.txt''. This should be accomplished by utilizing the base pairing rules of A-T and C-G
+
*Key command in this assignment would be ''sed''; various kinds of pattern replacements, combined together, can prove to be very powerful (should allow me to convert DNA to mRNA, and mRNA to an amino acid sequence)
=== Finding the Complementary Strand ===
=== Finding the Complementary Strand ===
−
*<code>sed "y/atcg/tagc/"</code> was found to replace all lowercase a's, t's, c's, and g's with t's, a's, g's, and c's respectively (in lines of text)
+
*<code>sed "y/atcg/tagc/"</code> was found to replace all lowercase a's, t's, c's, and g's with t's, a's, g's, and c's respectively (in lines of text); this command should allow me to find the complementary strand
*Using ''prokarote.txt'', the given nucleotide sequence, the complementary strand was found by using <code>cat prokaryote.txt | sed "y/atcg/tagc/"</code>
*Using ''prokarote.txt'', the given nucleotide sequence, the complementary strand was found by using <code>cat prokaryote.txt | sed "y/atcg/tagc/"</code>
*The given nucleotide sequence was:
*The given nucleotide sequence was:
*''genetic-code.sed'' was found to contain all of the sed replacement commands needed to convert any mRNA triplet to an amino acid
*''genetic-code.sed'' was found to contain all of the sed replacement commands needed to convert any mRNA triplet to an amino acid
*The large amount of sed replacement commands in ''genetic-code.sed'' made it apparent that linking them all together in one pipeline would be difficult and tedious. All of ''genetic-code.sed'', ideally, would be exploited in one command
*The large amount of sed replacement commands in ''genetic-code.sed'' made it apparent that linking them all together in one pipeline would be difficult and tedious. All of ''genetic-code.sed'', ideally, would be exploited in one command