*<code>aaaaggtcggtttaaccggcctttttatt</code> is 29 characters long, and given that <code>aaaaggt</code> is 7 characters long, a ''sed'' command that works on the 22 characters after <code>aaaaggt</code> will be useful.

*<code>aaaaggtcggtttaaccggcctttttatt</code> is 29 characters long, and given that <code>aaaaggt</code> is 7 characters long, a ''sed'' command that works on the 22 characters after <code>aaaaggt</code> will be useful.

*From the [[More Text Processing Features |More Text Processing Features page]], I learned that <code>sed ':a;N;$!ba;s/\n//g'</code> removes all of the line-breaks in text and makes it into a single "line".

*From the [[More Text Processing Features |More Text Processing Features page]], I learned that <code>sed ':a;N;$!ba;s/\n//g'</code> removes all of the line-breaks in text and makes it into a single "line".

*I added <code>sed "s/aaaaggt/<terminator>&\n/g" | sed -r "10s/^.{22}/&<\/terminator>/g" | sed ':a;N;$!ba;s/\n//g'</code> to the current chain; I found that every region was properly tagged and that all of the line-breaks were removed. <code>sed -r "10s/^.{22}/&<\/terminator>/g"</code> involves the first 22 characters of line 10 because the terminator is 29 bp (22 + 7 = 29).

*I added <code>sed "s/aaaaggt/<terminator>&\n/g" | sed -r "10s/^.{22}/&<\/terminator>/g" | sed ':a;N;$!ba;s/\n//g'</code> to the current chain; I found that every region was properly tagged and that all of the line-breaks were removed. <code>sed -r "10s/^.{22}/&<\/terminator>/g"</code> involves the first 22 characters of line 10 because the terminator is 29 bp (22 + 7 = 29).

*The final chain of commands is: <code>cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&<minus10box>\n/g" | sed -r "3s/^.{6}/&<\/minus10box>\n/g" | sed -r "4s/^.{5}/&<tss>\n/g" | sed -r "5s/^.{1}/&<\/tss>\n/g" | sed "s/gagg/<rbs>&<\/rbs>\n/g" | sed -r "7s/atg/<start_codon>&<\/start_codon>\n/1" | sed "s/.../ & /g" | sed -r "8,100000s/taa|tag|tga/<stop_codon>&<\/stop_codon>\n/1" | sed "s/ //g" | sed "s/aaaaggt/<terminator>&\n/g" | sed -r "10s/^.{22}/&<\/terminator>/g" | sed ':a;N;$!ba;s/\n//g'</code>

*The final chain of commands is: <code>cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&<minus10box>\n/g" | sed -r "3s/^.{6}/&<\/minus10box>\n/g" | sed -r "4s/^.{5}/&<tss>\n/g" | sed -r "5s/^.{1}/&<\/tss>\n/g" | sed "s/gagg/<rbs>&<\/rbs>\n/g" | sed -r "7s/atg/<start_codon>&<\/start_codon>\n/1" | sed "s/.../ & /g" | sed -r "8,100000s/taa|tag|tga/<stop_codon>&<\/stop_codon>\n/1" | sed "s/ //g" | sed "s/aaaaggt/<terminator>&\n/g" | sed -r "10s/^.{22}/&<\/terminator>/g" | sed ':a;N;$!ba;s/\n//g' | sed -r "s/<minus35box>|<minus10box>|<tss>|<rbs>|<start_codon>|<stop_codon>|<terminator>/ &/g" | sed -r "s/<\/minus35box>|<\/minus10box>|<\/tss>|<\/rbs>|<\/start_codon>|<\/stop_codon>|<\/terminator>/& /g"</code>

'''[[Media:bl_output_final.png|Final Output]]'''

'''[[Media:bl_output_final.png|Final Output]]'''

===Fully Tagged Sequence===

===Fully Tagged Sequence===