Vpachec3 Week 4 - Revision history

Vpachec3: Added commentary to Q3

2015-09-29T06:42:40Z

Added commentary to Q3

Vpachec3: Added answer for Q2

2015-09-29T06:13:48Z

Added answer for Q2

Vpachec3: Added process for terminator

2015-09-29T06:05:42Z

Added process for terminator

Vpachec3: Added final process thoughts for Stop Codon Tag

2015-09-29T05:25:50Z

Added final process thoughts for Stop Codon Tag

Vpachec3: Added more process comments

2015-09-29T05:19:09Z

Added more process comments

Vpachec3: Adding preliminary steps

2015-09-29T04:35:21Z

Adding preliminary steps

Vpachec3: Added start codon tag and commentary on process

2015-09-27T20:55:02Z

Added start codon tag and commentary on process

Vpachec3: Added the final step for ribosome binding site tag

2015-09-27T20:41:21Z

Added the final step for ribosome binding site tag

Vpachec3: Added the second step for the ribosome binding site

2015-09-27T20:39:17Z

Added the second step for the ribosome binding site

Vpachec3: Added the first step of ribosome binding site

2015-09-27T20:35:40Z

Added the first step of ribosome binding site

← Older revision		Revision as of 06:42, 29 September 2015
Line 118:		Line 118:
	And because the replacement happened throughout the whole sequence, I am going to go back and fix the tags. I know that for much larger sequences it might be a hassle to do so but in this case it its manageable.		And because the replacement happened throughout the whole sequence, I am going to go back and fix the tags. I know that for much larger sequences it might be a hassle to do so but in this case it its manageable.
	aacg<tss>g</tss>gccaaguuuaaugccaucacuauggggu<rbs>cucc</rbs>uaaucuac<start_codon>uac</start_codon>cgguuucuucuguuaua<stop_codon>acu</stop_codon>uuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcuca<terminator>uuuuccagccaaauuggccggaaaaauaa</terminator>		aacg<tss>g</tss>gccaaguuuaaugccaucacuauggggu<rbs>cucc</rbs>uaaucuac<start_codon>uac</start_codon>cgguuucuucuguuaua<stop_codon>acu</stop_codon>uuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcuca<terminator>uuuuccagccaaauuggccggaaaaauaa</terminator>
		+
		+	==Q3==
		+
		+	Now this command, "sed "s/.../ & /g" , I am familiar with because it messed me up when I first tried to do my super long compacted command line. I am going to use it in this case to begin to get the amino acid sequence.
		+
		+	It also applied the command to the tags which was a bit messy but it would be cleaned up soon enough by adding this command:
		+	sed -f genetic-code.sed
		+
		+

← Older revision		Revision as of 06:13, 29 September 2015
Line 103:		Line 103:

	ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc<minus35box>tttact</minus35box>tatttacagaacttcgg<minus10box>cattat</minus10box>cttgc<tss>c</tss>cggttcaaattacggtagtgatacccca<rbs>gagg</rbs>attagatg<startcodon>atg</start_codon>gccaaagaagacaatat<stop_codon>tga</stop_codon>aatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagt<terminator>aaaaggtcggtttaaccggcctttttatt</terminator>ttat		ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc<minus35box>tttact</minus35box>tatttacagaacttcgg<minus10box>cattat</minus10box>cttgc<tss>c</tss>cggttcaaattacggtagtgatacccca<rbs>gagg</rbs>attagatg<startcodon>atg</start_codon>gccaaagaagacaatat<stop_codon>tga</stop_codon>aatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagt<terminator>aaaaggtcggtttaaccggcctttttatt</terminator>ttat
		+	== Q2==
		+
		+	I used this command:
		+	sed "y/atcg/uagc/"
		+
		+	This would cause this result:
		+
		+	aaaagugguguucuuacuuacaaaagccguguaaagaggggucucacaauauuaacgccagcgucucaaccaaugcgaguaauggggcgacggcuauuccuuaaaaagcgcaguccauugcggguagcaaauagaguggcgagggaauaugcaacgcgaaaaccacgccgaaucggcacacaaaagccucauuacacggcuuggacaaacaacgcuaaaucgcgcguuuag<minus35box>aaauga</minus35box>auaaaugucuugaagcc<minus10box>guaaua</minus10box>gaacg<ass>g</ass>gccaaguuuaaugccaucacuauggggu<rbs>cucc</rbs>uaaucuac<sauragodon>uac</saura_godon>cgguuucuucuguuaua<saop_godon>acu</saop_godon>uuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcuca<aerminuaor>uuuuccagccaaauuggccggaaaaauaa</aerminuaor>aaua
		+
		+
		+	And we know from biology that transcription starts from the transcription start site to the terminator. So I'm just going to cut that out using copy and paste to get:
		+	aacg<ass>g</ass>gccaaguuuaaugccaucacuauggggu<rbs>cucc</rbs>uaaucuac<sauragodon>uac</saura_godon>cgguuucuucuguuaua<saop_godon>acu</saop_godon>uuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcuca<aerminuaor>uuuuccagccaaauuggccggaaaaauaa</aerminuaor>
		+
		+	And because the replacement happened throughout the whole sequence, I am going to go back and fix the tags. I know that for much larger sequences it might be a hassle to do so but in this case it its manageable.
		+	aacg<tss>g</tss>gccaaguuuaaugccaucacuauggggu<rbs>cucc</rbs>uaaucuac<start_codon>uac</start_codon>cgguuucuucuguuaua<stop_codon>acu</stop_codon>uuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcuca<terminator>uuuuccagccaaauuggccggaaaaauaa</terminator>
		+

	==Links==		==Links==

← Older revision		Revision as of 06:05, 29 September 2015
Line 90:		Line 90:

	===Terminator===		===Terminator===
		+	At this point I am struggling and I need up using grep to find the hairpin. We know the hair pin is aaaaggt so I used grep to search it in the file. After that I used:
		+
		+	sed "s/gcctttttatt/&<\/terminator>/g"
		+
		+	But this did not work because I actually need them to not be separated into triplets.
		+
		+	Well it looked like I got myself into a hole that I couldn't get out of. So I redid my command. The command line I had had the correct placement of where things should be so I used that information to edit the command line.
		+
		+	sed "s/cattat/<minus10box>&<\/minus10box>/g" infA-E.coli-K12.txt \| sed "s/tttact/<minus35box>&<\/minus35box>/g" \| sed -r "s/<\/minus10box>.{5}/&<\/tss>/g" \| sed "s/<\/tss>/<tss>c&/g" \| sed "s/gagg/<rbs>&<\/rbs>/g" \| sed -r "s/<\/rbs>.{8}/&<\/start_codon>/g" \| sed "s/<\/start_codon>/<startcodon>atg&/g" \| sed "1s/tga/<stop_codon>&<\/stop_codon>/3" \| sed "s/aaaaggt/<terminator>&/g" \| sed "s/gcctttttatt/&<\/terminator>/g"
		+
		+	and I FINALLY got the sequence:
		+
		+	ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc<minus35box>tttact</minus35box>tatttacagaacttcgg<minus10box>cattat</minus10box>cttgc<tss>c</tss>cggttcaaattacggtagtgatacccca<rbs>gagg</rbs>attagatg<startcodon>atg</start_codon>gccaaagaagacaatat<stop_codon>tga</stop_codon>aatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagt<terminator>aaaaggtcggtttaaccggcctttttatt</terminator>ttat

	==Links==		==Links==

← Older revision		Revision as of 05:25, 29 September 2015
Line 78:		Line 78:

	sed "2s/.../& /g"\| sed "2s/tag\|tga\|taa/ <stop_codon>& <\/stop_codon> /1"		sed "2s/.../& /g"\| sed "2s/tag\|tga\|taa/ <stop_codon>& <\/stop_codon> /1"
		+
		+	But alas, I finally figured it out! I used this command to add the tags:
		+	sed "2s/.../& /g"\| sed -r "2s/tag \|taa \|tga /<stop_codon>& <\/stop_codon>/1"
		+
		+	And now I need to put the sequence back together
		+
		+	ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact </minus35box> tatttacagaacttcgg <minus10box>cattat </minus10box> cttgccggttcaaatta <tss>c </tss> ggtagtgatacccca <rbs>gagg </rbs> attag <start_codon>atg </start_codon> gcc aaa gaa gac aat att gaa atg caa ggt acc gtt ctt gaa acg ttg cct aat acc atg ttc cgc gta gag tta gaa aac ggt cac gtg gtt act gca cac atc tcc ggt aaa atg cgc aaa aac tac atc cgc atc ctg acg ggc gac aaa gtg act gtt gaa ctg acc ccg tac gac ctg agc aaa ggc cgc att gtc ttc cgt agt cgc <stop_codon>tga </stop_codon>ttg ttt tac cgc ctg atg ggc gaa gag aaa gaa cga gta aaa ggt cgg ttt aac cgg cct ttt tat ttt at
		+
		+
		+	The second line is still in triplets but I am not going to change it since I feel like it will come in handy later on.

	===Terminator===		===Terminator===

← Older revision		Revision as of 05:19, 29 September 2015
Line 74:		Line 74:

	But then I realized the mistake. They need to be read in 3's which I realized I didn't specify in the first command. So now I need to add in the sed "s/.../& /g" command to let the computer know to read it in threes starting the second line.		But then I realized the mistake. They need to be read in 3's which I realized I didn't specify in the first command. So now I need to add in the sed "s/.../& /g" command to let the computer know to read it in threes starting the second line.
		+
		+	I added this command but it didn't insert the stop_codon in the appropriate place. It didn't even put it in the sequence.
		+
		+	sed "2s/.../& /g"\| sed "2s/tag\|tga\|taa/ <stop_codon>& <\/stop_codon> /1"

	===Terminator===		===Terminator===

← Older revision		Revision as of 04:35, 29 September 2015
Line 65:		Line 65:

	===Stop Codon===		===Stop Codon===
		+	Unlike the start codon, the stop codon has more than one possible combination. So what I am thinking is to break the sequence into two lines and putting in the command to search for multiple combination: sed "s/.../& /g"
		+
		+	So I tried this command:
		+	cat infA-E.coli-K12.txt \| sed "s/tt[gt]ac[at]/ <minus35box>& <\/minus35box> /1" \|sed "s/[ct]at[at]at/ <minus10box>& <\/minus10box> /2"\| sed "s/ <\/minus10box> /&\n/g"\| sed "2s/c/ <tss>& <\/tss> /5"\| sed ':a;N;$!ba;s/\n//g'\| sed "s/ <\/tss> /&\n/g"\| sed "2s/gagg/ <rbs>& <\/rbs> /1" \|sed ':a;N;$!ba;s/\n//g'\| sed "s/ <\/rbs> /&\n/g"\| sed "2s/atg/ <start_codon>& <\/start_codon> /1"\| sed ':a;N;$!ba;s/\n//g' \| sed "s/ <\/start_codon> /&\n/g"\| sed "2s/tga\|tag\|taa/ <stop_codon>& <\/stop_codon> /g"
		+
		+
		+	And it appeared not to work. Initially, I had no clue why. I tried multiple variations of the command and it still wasn't really working. I tried playing around with it. So my method, not particularly efficient, but still work was to search the 3 tags (tga, tag, taa) individually and see which one of the three came first.
		+
		+	But then I realized the mistake. They need to be read in 3's which I realized I didn't specify in the first command. So now I need to add in the sed "s/.../& /g" command to let the computer know to read it in threes starting the second line.

	===Terminator===		===Terminator===

← Older revision		Revision as of 20:55, 27 September 2015
Line 61:		Line 61:

	=== Start Codon===		=== Start Codon===
		+	From biology, we know that the start codon is atg and it falls after the ribosome binding site. So I will divide the sequence into two lines once again and add the start codon tag. After this is done, I will put the two lines back together. Now thinking about it, I could have left the lines into 2 or even 3 until all the tags are added then combined the lines after. However, this is good for practice. Here is the final product:
		+	ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact </minus35box> tatttacagaacttcgg <minus10box>cattat </minus10box> cttgccggttcaaatta <tss>c </tss> ggtagtgatacccca <rbs>gagg </rbs> attag <start_codon>atg </start_codon> gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat

	===Stop Codon===		===Stop Codon===

@@ Line 56: / Line 56: @@
 Then I added the ribosome binding site tag into the second line:
   cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>& <\/minus35box> /1" |sed "s/[ct]at[at]at/ <minus10box>& <\/minus10box> /2"| sed "s/ <\/minus10box> /&\n/g"| sed "2s/c/ <tss>& <\/tss> /5"|  sed ':a;N;$!ba;s/\n//g'| sed "s/ <\/tss> /&\n/g"| sed "2s/gagg/ <rbs>& <\/rbs> /1"
 === Start Codon===

@@ Line 50: / Line 50: @@
 ===Ribosome Binding Site===
 I assume that adding the ribosome binding site would be similar to adding in the other tags. The tricky part should be where to put the tag on the sequence. This is the information given:"A consensus sequence for the ribosome binding site is gagg". So I'm going to break the sequence into two lines and look for the gagg pattern after the transcription start site.
 === Start Codon===