Difference between revisions of "Kzebrows Week 2"
(Journal Entry Week 2 submission.) |
(Addition of heading.) |
||
Line 1: | Line 1: | ||
+ | ==Journal Assignment, Week 2== | ||
+ | |||
+ | '''Given DNA strand:''' | ||
5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’ | 5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’ | ||
+ | |||
+ | '''Complementary strand:''' | ||
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5' | 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5' | ||
− | + | '''Translation of all possible reading frames of this DNA sequence:''' | |
'''Top strand''' (mRNA-like): | '''Top strand''' (mRNA-like): | ||
Line 65: | Line 70: | ||
+1, -2, and -3 do not contain stop codons and are therefore open reading frames. This makes sense because -1, +2, and +3 do contain stop codons, and they are the opposite of each other (antisense). | +1, -2, and -3 do not contain stop codons and are therefore open reading frames. This makes sense because -1, +2, and +3 do contain stop codons, and they are the opposite of each other (antisense). | ||
− | |||
{{Template:Kzebrows}} | {{Template:Kzebrows}} | ||
[[Category : Journal Entry]] | [[Category : Journal Entry]] |
Latest revision as of 05:36, 15 September 2015
Contents
Journal Assignment, Week 2
Given DNA strand:
5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
Complementary strand:
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5'
Translation of all possible reading frames of this DNA sequence:
Top strand (mRNA-like):
5'-cgu aug cua aua cca ugu ucc gcg uau aac cca gcc gcc agu ucc gcu ggc ggc auu uua-3'
+1 translates to
5'-R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-3'
whereas +2
5'-gua ugc uaa uac cau guu ccg cgu aua acc cag ccg cca guu ccg cug gcg gca uuu-3'
translates to
5'-V-C-stop-3'
whereas 3+
5'-uau gcu aau acc aug uuc cgc gua uaa ccc agc cgc cag uuc cgc ugg cgg cau-3'
translates to
5'-T-A-N-T-M-F-R-V-stop-3'
Bottom strand (template) translates to:
3'-gca tac gat tat ggt aca agg cgc ata ttg ggt cgg cgg tca agg cga ccg ccg taa aat 5'
Read 5' to 3', this sequence looks like this:
5'-taa aat gcc gcc agc gga act ggc ggc tgg gtt ata cgc gga aca tgg tat tag cat acg-3'
Translated into mRNA, this sequence looks like this:
5'-uaa aau gcc gcc agc gga acu ggc ggc ugg guu aua cgc gga aca ugg uau uag cau acg-3'
In the -1 reading frame, this translates into:
5'-stop-3'
In the -2 reading frame this translates into:
5'-aaa aug ccg cca gcg gaa cug gcg gcu ggg uua uac gcg gaa cau ggu auu agc aua -3'
This translates into:
5'-K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I-3'
In the -3 reading frame
5'-aaa ugc cgc cag cgg aac ugg cgg cug ggu uau acg cgg aac aug gua uua gca uac-3'
This translates into:
5'-K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y-3'
Which of the reading frames (if any) of the reading frames you translated is an open reading frame, i.e., does not contain a stop codon?
+1, -2, and -3 do not contain stop codons and are therefore open reading frames. This makes sense because -1, +2, and +3 do contain stop codons, and they are the opposite of each other (antisense).
Assignments
Individual Journal Assignment Pages
- Week 1
- Week 2
- Week 3
- Week 4
- Week 5
- Week 6
- Week 7
- Week 8
- Week 9
- Week 10
- Week 11
- Week 12
- Week 14
- Week 15
Individual Journal Assignments
- Kzebrows Week 1
- Kzebrows Week 2
- Kzebrows Week 3
- Kzebrows Week 4
- Kzebrows Week 5
- Kzebrows Week 6
- Kzebrows Week 7
- Kzebrows Week 8
- Kzebrows Week 9
- Kzebrows Week 10
- Kzebrows Week 11
- Kzebrows Week 12
- Kzebrows Week 14
- Kzebrows Week 15
- Final Individual Reflection
- Class Journal Week 1
- Class Journal Week 2
- Class Journal Week 3
- Class Journal Week 4
- Class Journal Week 5
- Class Journal Week 6
- Class Journal Week 7
- Class Journal Week 8
- Class Journal Week 9
- Oregon Trail Survivors Week 10
- Oregon Trail Survivors Week 11
- Oregon Trail Survivors Week 12
- Oregon Trail Survivors Week 14
Additional Links
- User Page: Kristin Zebrowski
- Class Page: BIOL/CMSI 367-01
- Team Page: Oregon Trail Survivors