Difference between revisions of "Kevin Wyllie Week 3"

Revision as of 01:44, 20 September 2015

Complement of a Strand

• Shown in green: the following command is used to open the file (using prokaryote.txt as an example).

cat prokaryote.txt

• Shown in red: the following command is used to sequence the complementary strand (in the 5' -> 3' direction - thus the "rev" command).

cat prokaryote.txt | sed "y/atgc/tacg/" | rev

• These commands yield the nucleotide sequence:

• • 5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3'

Reading Frames

The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.

+1, +2, and +3 Frames

• Shown in green: to separate the strand into codons (resulting in the +1 frame):

cat prokaryote.txt | sed "s/.../& /g"

• Shown in red: to convert to the mRNA sequence (treating the DNA stand as the mRNA-like strand):

cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/"

• Shown in blue: to translate this mRNA sequence (yielding the +1 frame):

cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• For the +2 frame, the final pipe can be slightly altered:

cat prokaryote.txt | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• And similarly, for the +3 frame:

cat prokaryote.txt | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• These pipes yield the following amino acid sequences (shown on right):
  
  • +1 Nter- S T I F Q -Cter (shown in green)
  • +2 Nter- L L Y F N R Y D G Q R R Q Y -Cter (shown in red)
  • +3 Nter- Y Y I S I G T M A K E D N I E L E T L P N T M F R V -Cter (shown in blue)

-1, -2, and -3 Frames

• For the -1 frame, open the file as usual, and then use the pipe from "Complement of a Strand" so that the commands after it will be applied to the complementary strand (instead of the original strand). Then, add the same pipe used for the +1 strand:

cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• As before, the -2 and -3 frames can be found by making a single adjustment to the pipe for the -1 frame. For the -2 frame:

cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• And for the -3 frame:

cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed