Difference between revisions of "Emilysimso Week 4"

Latest revision as of 22:41, 26 September 2015

Question 1

• Used grep "[ct]at[at]at" infA-E.coli-K12.txt to highlight the -10box
• Used grep "tt[gt]ac[at]" infA-E.coli-K12.txt to highlight the -35 box
• Used sed "s/cattat/<minus10box>&<\/minus10box>/g" infA-E.coli-K12.txt | sed "s/tttact/<minus35box>&<\/minus35box>/g" to add the labels to the -35box and -10box

• Added sed -r "s/<\/minus10box>.{11}/<tss>&<\/tss>/g"
  • This did not work because the <tss> label got added before the </minus10box>

• Used sed -r "s/<\/minus10box>.{5}/&<\/tss>/g" | sed "s/<\/tss>/<tss>c&/g" to add the tss site markers

• Added grep "gagg" to find the rbs
• Added sed "s/gagg/<rbs>&<\/rbs>/g" around the gagg to mark the rbs

• Used grep "atg" to find possible start codons
• Added sed -r "s/<\/rbs>.{8}/&<\/startcodon>/g" | sed "s/<\/startcodon>/<startcodon>atg&/g" to mark the start codon (atg)

• Possible stop codons - taa, tag, or tga
• Used sed "s/.../ & /g" infA-E.coli-K12.txt | grep "taa" | grep "tag" | grep "tga" to find possible stop codons
  • tga is only possible stop codon
• Added sed "1s/tga/<stop_codon>&<\/stop_codon>/g"
  • Looked for first one after the start codon
• Added sed "1s/tga/<stop_codon>&<\/stop_codon>/3"

• Used sed "s/aaaaggt/<terminator>&/g" to mark the first part of the terminator
• Used grep "gcctttt" infA-E.coli-K12.txt to find the rest of the hairpin
  • Looked for next four bases - they were tatt
• Used sed "s/gcctttttatt/&<\/terminator>/g" to mark the end of the terminator

• Final command: sed "s/cattat/<minus10box>&<\/minus10box>/g" infA-E.coli-K12.txt | sed "s/tttact/<minus35box>&<\/minus35box>/g" | sed -r "s/<\/minus10box>.{5}/&<\/tss>/g" | sed "s/<\/tss>/<tss>c&/g" | sed "s/gagg/<rbs>&<\/rbs>/g" | sed -r "s/<\/rbs>.{8}/&<\/start_codon>/g" | sed "s/<\/start_codon>/<startcodon>atg&/g" | sed "1s/tga/<stop_codon>&<\/stop_codon>/3" | sed "s/aaaaggt/<terminator>&/g" | sed "s/gcctttttatt/&<\/terminator>/g"
• Final result: ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc<minus35box>tttact</minus35box>tatttacagaacttcgg<minus10box>cattat</minus10box>cttgc<tss>c</tss>cggttcaaattacggtagtgatacccca<rbs>gagg</rbs>attagatg<startcodon>atg</start_codon>gccaaagaagacaatat<stop_codon>tga</stop_codon>aatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagt<terminator>aaaaggtcggtttaaccggcctttttatt</terminator>ttat

Question 2

• Took the strand from the tss to the end of the terminator
• Used sed "y/atcg/uagc/"
• Resulting sequence: ggccaaguuuaaugccaucacuauggggucuccuaaucuacuaccgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcucauuuuccagccaaauuggccggaaaaauaa

Question 3

• Used "sed "s/.../ & /g" to separate the sequence from Question 2 into codons
• Added sed -f genetic-code.sed
• Entered answer from Question 2 into type-able space
• Resulting sequence: G Q V - C H H Y G V S - S T T G F F C Y N F T F H G K N F A T D Y G T R R I S I F C Q C T N D V C R G H F T R F - C R R R T A R C F T D N L T G A C W T R F R R N R R H Q R L T K W R T T R F S F L L I F Q P N W P E K -

Weekly Assignment Information

User: Emilysimso

Assignments

• Week 1
• Week 2
• Week 3
• Week 4
• Week 5
• Week 6
• Week 7
• Week 8
• Week 9
• Week 10
• Week 11
• Week 12
• Week 13
• Week 14
• Week 15

Individual Journal Entries

• Emilysimso Week 2
• Emilysimso Week 3
• Emilysimso Week 4
• Emilysimso Week 5
• Emilysimso Week 6
• Emilysimso Week 7
• Emilysimso Week 8
• Emilysimso Week 9
• Emilysimso Week 10
• Emilysimso Week 11
• Emilysimso Week 12
• Emilysimso Week 13
• Emilysimso Week 14
• Emilysimso Week 15

Class Journal Entries

• Class Journal Week 1
• Class Journal Week 2
• Class Journal Week 3
• Class Journal Week 4
• Class Journal Week 5
• Class Journal Week 6
• Class Journal Week 7
• Class Journal Week 8
• Class Journal Week 9
• Class Journal Week 10
• Class Journal Week 11
• Class Journal Week 12
• Class Journal Week 13
• Class Journal Week 14
• Class Journal Week 15

Group Project

Heavy Metal HaterZ