Difference between revisions of "Blitvak Week 4"

Revision as of 22:14, 27 September 2015

Individual Journal Assignment Week 4

Finding the -35 and -10 boxes of the promoter

• I first found infA-E.coli-K12.txt by entering the correct directory, cd ~dondi/xmlpipedb/data.
• I copied the sequence kept in that file on an external space for future reference/checking.
• I assumed that the sequence is the mRNA-like strand and that it runs from 5'- 3'.
• By reading the Week 4 Assignment Page, I found that the -10 box is generally [ct]at[at]at, and that the -35 box is generally tt[gt]ac[at]
• I skimmed over the More Text Processing Features page, and I found that sed "s/Title/<h1>&<\/h1>/g" results in an output of <h1>Title</h1>; this command would be useful in tagging the sequence with its various parts.
• I then tried cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>/g"| sed "s/[ct]at[at]at/<minus10box>&<\/minus10box>/g".
  • Gave me the output:

ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgt<minus10box>tataat</minus10box>tgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggag
taatgtgccgaacctgtttgttgcgatttagcgcgcaaatc<minus35box>tttact</minus35box>ta<minus35box>tttaca</minus35box>gaacttcgg<minus10box>cattat</minus10box>cttgccggttcaaattacggtagtgataccccagaggattagatggccaaagaagacaatattgaaatgc
aaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaa
gagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat

• I realized that there are two possibilities for the minus35box and one for the minus10box (since the minus10box must come after the minus35box, the first instance of a "minus10box" is to be ignored).
• I looked at the Week 4 Assignment Page, and I found that there is an ideal number of 17 base pairs between the -35 and -10 box. Only <minus35box>tttact</minus35box> fits this criteria (is 17 bp away from <minus10box>cattat</minus10box>).
• In the More Text Processing Features page, I found that sed "s/paragraph/&\n/g" results in a line-break right after the pattern gets matched/replaced (this would be useful in making the text more manageable for sed, as it is line centric). From referencing that same page, I found that replacing the g in the s///g format with a number, n, will result in sed replacing only the nth match on that line. Some of these sequences, that correspond to specific parts of the DNA strand, result in multiple matches; it would be fairly useful to limit sed to one replacement by making it only work on the nth match.
• I realized that adding a number before the s in the s///g format will limit sed to that line (ex. executing 2s///g, results in a replacement being made on the 2nd line). It should be useful to make several line-breaks in order to make any matching easier; later, these line-breaks will have to be removed.
• In an in-class work session, I learned that sed -r "<line#>s/^.{n}/<replacement>/g" limits sed to the first n characters of a line.
• I executed cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1"| sed -r "2s/^.{17}/&<minus10box>\n/g" | sed -r "3s/^.{6}/&<\/minus10box>\n/g" (took me some time to realize that the -r was necessary for this command to work!). In making up this command, I decided to add a break after finding the minus35box and I limited sed to the first match (since I realized that the first match for the minus35box is, in fact, the correct one). Since the minus10box is 17 bp away from the minus35box, I decided to add the <minus10box> part of the tag after those 17 characters of the second line. I then decided to create another line-break after placing the first part of the minus10box tag; on the third line, I exploited the fact that the minus10box is 6 bp long in order to create a sed command that would add the last part of the tag, </minus10box>, after the actual minus10box.
  • Output so far