*I realized, by reading the [[Week 4 | Week 4 Assignment Page]], that, in mRNA, the u's in the hairpin connect to the g's in the hairpin. From observing some [https://upload.wikimedia.org/wikipedia/commons/thumb/3/3f/Stem-loop.svg/2000px-Stem-loop.svg.png examples] of hairpins, I found that the two halves of the hairpin are supported by several nucleotides between them (I also learned that the second half wraps around and connects to the first half in a reverse position).

*I realized, by reading the [[Week 4 | Week 4 Assignment Page]], that, in mRNA, the u's in the hairpin connect to the g's in the hairpin. From observing some [https://upload.wikimedia.org/wikipedia/commons/thumb/3/3f/Stem-loop.svg/2000px-Stem-loop.svg.png examples] of hairpins, I found that the two halves of the hairpin are supported by several nucleotides between them (I also learned that the second half wraps around and connects to the first half in a reverse position).

*I began to look at the nucleotides that come after the <terminator> part of the tag via <code>sed "s/aaaaggt/<terminator>&\n/g"</code> tied to the current chain, which are <code>cggtttaaccggcctttttattttat</code>.

*I began to look at the nucleotides that come after the <terminator> part of the tag via <code>sed "s/aaaaggt/<terminator>&\n/g"</code> tied to the current chain, which are <code>cggtttaaccggcctttttattttat</code>.