Difference between revisions of "Jwoodlee Week 4"
(→Transcription and Translation “Taken to the Next Level”: added ELN for amino acid sequence) |
(formatting) |
||
| Line 58: | Line 58: | ||
aaaacuacauccgcauccugacgggcgacaaagugacuguugaacugaccccguacgaccugagcaaaggccgcauugu | aaaacuacauccgcauccugacgggcgacaaagugacuguugaacugaccccguacgaccugagcaaaggccgcauugu | ||
cuuccguagucgcugauuguuuuaccgccugaugggcgaagagaaagaacgaguaaaaggucgguuuaaccggccuuuuuauu | cuuccguagucgcugauuguuuuaccgccugaugggcgaagagaaagaacgaguaaaaggucgguuuaaccggccuuuuuauu | ||
| − | |||
**(b) | **(b) | ||
| − | + | <code>cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | |
| sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | ||
| sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>\n/1" | | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>\n/1" | ||
| Line 67: | Line 66: | ||
| sed "s/>/&\n/g" | sed "s/</\n&/g" | sed "1,10D;12D;14D;16D;18D;20D;22D;24D;26D;28D;29D" | | sed "s/>/&\n/g" | sed "s/</\n&/g" | sed "1,10D;12D;14D;16D;18D;20D;22D;24D;26D;28D;29D" | ||
| sed ':a;N;$!ba;s/\n//g' | sed "s/t/u/g" </code> | | sed ':a;N;$!ba;s/\n//g' | sed "s/t/u/g" </code> | ||
| − | |||
| − | |||
* What is the amino acid sequence that is translated from this mRNA? | * What is the amino acid sequence that is translated from this mRNA? | ||
| − | **Now I do the same thing as in the mRNA commands except the lines I delete are different. I want to keep everything between the start and stop codon inclusive. I then need to pipe that over to the genetic code sed file that | + | **Now I do the same thing as in the mRNA commands except the lines I delete are different. I want to keep everything between the start and stop codon inclusive. I then need to pipe that over to the genetic code sed file that Dondi made and I will have a completed amino acid sequence. |
**(a) | **(a) | ||
**(b) | **(b) | ||
Revision as of 23:25, 28 September 2015
Transcription and Translation “Taken to the Next Level”
This computer exercise examines gene expression at a much more detailed level than before, requiring knowledge in both the biological aspects of the process and the translation of these steps into computer text-processing equivalents.
The following sequence represents a real gene, called infA and found in E. coli K12. As you might have guessed, it’s stored as infA-E.coli-K12.txt in ~dondi/xmlpipedb/data.
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgc tcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgtt gcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc tttacttatttacagaacttcggcattatcttgccggttcaaattacggtagtgataccccagaggattagatggcc aaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaa cggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtga ctgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatg ggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat
For each of the following questions pertaining to this gene, provide (a) the actual answer, and (b) the sequence of text-processing commands that calculates this answer. Specific information about how these sequences can be identified is included after the list of questions.
I opened up terminal, and used the ssh command to get into dondi's directory: ~dondi/xmlpipedb/data. In there I got access to infA-E.coli-K12.txt which is the nucleotide sequence I will be using for this assignment.
- Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
- -35 box of the promoter
- As shown in class I used the sed command to get the first occurrence of the minus 35 strand in the sequence:
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box> \n/1"
- -10 box of the promoter
- In order to get the 10 box filled correctly I made a new line after the 35 box, counted 17 bits into the new line, and then made another new line. I then took the first occurrence of the 3rd line that matched the -10 box sequence. This obviously works to find the correct sequence, however it breaks up the entire sequence into 3 lines, so at the end I will have to remedy this.
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>/1"
- transcription start site
- Knowing that the TSS was 12 characters away from the first character of the -10 box, I counted 5 characters after the last -10 character, made a new line and then knew that the first character on that new line would be the TSS, how I did that can be seen in the commands below.
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>/g"
- ribosome binding site
- To find the ribosome binding site, I made a new line after the TSS and found the next occurrence of "gagg" as per the assignment specifications:
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>/1"
- start codon
- I found the start codon in much the same way as I found the rest of the sequences. I made a new line after the previous sequence, and then found the first occurrence of "atg", and then marked it up.
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>/1"
- stop codon
... <stop_codon>...</stop_codon> ...
- The stop codon requires I find one of three possible three character sequences. At first I tried using brackets: "t[ag][ag]", but I soon found out that that yielded too many results. There are only three stop codons and the brackets give me 4 unique codons. So into the wiki I went, and realized I could use a vertical bar to separate three unique codons, and search for them. The problem however, was that this did not work. After being stumped for awhile I realized that before I piped to that command I needed to break up the line into sets of 3, just like I did in the week 3 assignment. As a result I got this command:
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>\n/1" | sed "8s/.../& /g"| sed -r "8s/tag|tga|taa/<stop_codon>&<\/stop_codon>/1"
- The stop codon requires I find one of three possible three character sequences. At first I tried using brackets: "t[ag][ag]", but I soon found out that that yielded too many results. There are only three stop codons and the brackets give me 4 unique codons. So into the wiki I went, and realized I could use a vertical bar to separate three unique codons, and search for them. The problem however, was that this did not work. After being stumped for awhile I realized that before I piped to that command I needed to break up the line into sets of 3, just like I did in the week 3 assignment. As a result I got this command:
- terminator
- The first part of the terminator hairpin is:
aaaaggt, which means, abiding by the rules of the terminator provided to us, that the first half bonds withgcctttt. So now the trick is to grab the correct terminator sequence. I ended up breaking the terminator command into two different commands. I used one to insert the first tag, and the second one to insert the second tag. I did this because I wasn't sure how long the sequence would be between the two hairpin sequences. This is what I got to capture the terminator sequence:cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>\n/1" | sed "8s/.../& /g"| sed -r "8s/tag|tga|taa/<stop_codon>&<\/stop_codon>/1" | sed "8s/ //g" | sed "8s/aaaaggt/<terminator>&/g" | sed -r "8s/gcctttt..../&<\/terminator>/g"
- The first part of the terminator hairpin is:
- And so, finally, it is all marked up. However I'm not quite done yet, I need to get rid of all the new lines I created. In order to do this I used this command: sed ':a;N;$!ba;s/\n//g' (from wiki), so the final output is as follows.
- (a)
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcg gagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc<minus35box>tttact</minus35box>tatttacagaacttcgg<minus10box>cattat</minus10box>cttgc<tss>c</tss>ggttcaaattacggtagtgatacccca <rbs>gagg</rbs>attag<start_codon>atg</start_codon>gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttac tgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgc<stop_codon>tga</stop_codon> ttgttttaccgcctgatgggcgaagagaaagaacgagt<terminator>aaaaggtcggtttaaccggcctttttatt</terminator>ttat
- (b)And the final command is as follows:
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>\n/1" | sed "8s/.../& /g"| sed -r "8s/tag|tga|taa/<stop_codon>&<\/stop_codon>/1" | sed "8s/ //g" | sed "8s/aaaaggt/<terminator>&/g" | sed -r "8s/gcctttt..../&<\/terminator>/g" | sed ':a;N;$!ba;s/\n//g'
- What is the exact mRNA sequence that is transcribed from this gene?
- In order to get the mRNA sequence I need to get the sequence between the transcription start site and the terminator. I found it easiest to make new lines based on the mark up tags already there. From that point I can pick and choose which lines I need to transcribe. Using sed, I can delete lines. Example:
sed "2,4D"So, using this trick, I deleted all unnecessary lines. From there all nucleotides not deleted should be transcribed into mRNA. I was going to make new lines by typing out a bunch of different sed commands for each different tag, but I can do it simply by using two. This puts each tag on its own line:sed "s/>/&\n/g" | sed "s/</\n&/g". Now I go through, delete the tags and the useless sequences, remove the extra lines, and transcribe. Here is the sequence followed by the command. - (a)
- In order to get the mRNA sequence I need to get the sequence between the transcription start site and the terminator. I found it easiest to make new lines based on the mark up tags already there. From that point I can pick and choose which lines I need to transcribe. Using sed, I can delete lines. Example:
cgguucaaauuacgguagugauaccccagaggauuagauggccaaagaagacaauauugaaaugcaagguaccguucuug aaacguugccuaauaccauguuccgcguagaguuagaaaacggucacgugguuacugcacacaucuccgguaaaaugcgca aaaacuacauccgcauccugacgggcgacaaagugacuguugaacugaccccguacgaccugagcaaaggccgcauugu cuuccguagucgcugauuguuuuaccgccugaugggcgaagagaaagaacgaguaaaaggucgguuuaaccggccuuuuuauu
- (b)
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1"
| sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g"
| sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>\n/1"
| sed "8s/.../& /g"| sed -r "8s/tag|tga|taa/<stop_codon>&<\/stop_codon>/1" | sed "8s/ //g"
| sed "8s/aaaaggt/<terminator>&/g" | sed -r "8s/gcctttt..../&<\/terminator>/g" | sed ':a;N;$!ba;s/\n//g'
| sed "s/>/&\n/g" | sed "s/</\n&/g" | sed "1,10D;12D;14D;16D;18D;20D;22D;24D;26D;28D;29D"
| sed ':a;N;$!ba;s/\n//g' | sed "s/t/u/g"
- What is the amino acid sequence that is translated from this mRNA?
- Now I do the same thing as in the mRNA commands except the lines I delete are different. I want to keep everything between the start and stop codon inclusive. I then need to pipe that over to the genetic code sed file that Dondi made and I will have a completed amino acid sequence.
- (a)
- (b)