|
|
| | acuacauccgcauccugacgggcgacaaagugacuguugaacugaccccguacgaccugagcaaaggccgcauugucuuccg | | acuacauccgcauccugacgggcgacaaagugacuguugaacugaccccguacgaccugagcaaaggccgcauugucuuccg |
| | uagucgcugauuguuuuaccgccugaugggcgaagagaaagaacgaguaaaaggucgguuuaaccggccuuuuuauu | | uagucgcugauuguuuuaccgccugaugggcgaagagaaagaacgaguaaaaggucgguuuaaccggccuuuuuauu |
| | + | ===Determining the Translation Product (Part #3)=== |
| | + | ''Translation'' begins at the start codon "aug" and ends at the stop codon, in this case "tga". The file ''genetic-code.sed'' can be used to apply the genetic code to an mRNA sequence as in week 3, but the above sequence must first be trimmed to begin with the start codon and end with the stop codon. There are many ways to do this. I chose to go back in the command sequence from part #2 and section off the sequence from the start codon to the stop codon before deleting the tags. After this, I reached back to the individual assignment from week 3 to get the command sequence for translation using the ''genetic-code.sed''. The specific alterations I made to the command sequence in part #2 are listed below: |
| | + | #I deleted the last two commands in the sequence, which consisted of the following: <code> sed -r "s/\/|<|>//g;s/tss|rbs|start_codon|stop_codon|terminator//g" | sed "s/t/u/g"</code>. |
| | + | #I added a command to insert line breaks after the <code><start_codon></code> tag and before the <code></stop_codon></code> tag: <code>sed "s/<start_codon>/&\n/g;s/<\/stop_codon>/\n&/g"</code>. |
| | + | #I added a command identical to one used prior in the sequence to delete the first and third lines, therefore isolating the sequence from start to stop codon: <code>sed "1D;3D"</code>. |
| | + | #I added a command to delete the remaining tags: <code>sed "s/<\/start_codon>//g;s/<stop_codon>//g"</code>. |
| | + | #Finally, I added a slightly more condensed version of the command sequence used in week 3 to carry out translation, also reading the command to convert t's to u's that I had deleted in step 1: <code>sed "s/t/u/g;s/.../& /g" | sed -f genetic-code.sed | sed "s/[atcg]//g;s/ //g"</code>. |
| | + | #The final command sequence for translation and its corresponding output are listed below: |
| | + | sed "s/tt[gt]ac[at]/<minus35box>&<\/mius35box>\n/1" infA-E.coli-K12.txt | sed -r "2s/^.{17}/& |
| | + | <minus10box>/g" | sed "s/<minus10box>....../&<\/minus10box>/g" | sed -r "s/<\/minus10box>.{5} |
| | + | /&<tss>/g;s/<tss>./&<\/tss>\n/g" | sed "3s/gagg/<rbs>&<\/rbs>\n/g" | sed "4s/atg/<start_codon>& |
| | + | <\/start_codon>\n/1" | sed "5s/aaaaggt/\n<terminator>&/g" | sed -r "6s/aaaaggt.*gcctttt.{4}/& |
| | + | <\/terminator>/g"| sed "5s/.../& /g" | sed -r "5s/taa|tag|tga/<stop_codon>&<\/stop_codon>/1" |
| | + | | sed "5s/ //g" | sed ':a;N;$!ba;s/\n//g' | sed "s/<tss>/&\n/g;s/<\/terminator>/\n&/g" | sed "1D;3D" |
| | + | | sed "s/<start_codon>/&\n/g;s/<\/stop_codon>/\n&/g" | sed "1D;3D" | sed"s/<\/start_codon>//g; |
| | + | s/<stop_codon>//g" | sed "s/t/u/g;s/.../& /g" | sed -f genetic-code.sed | sed "s/[atcg]//g;s/ //g" |
| | | | |
Exception encountered, of type "Error"
[7f827865] /biodb/fall2015/index.php?diff=1887&oldid=1876&title=Bklein7_Week_4 Error from line 434 of /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php: Call to undefined function each()
Backtrace:
#0 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(544): DiffEngine->diag()
#1 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(344): DiffEngine->compareSeq()
#2 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(227): DiffEngine->diffLocal()
#3 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(721): DiffEngine->diff()
#4 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(859): Diff->__construct()
#5 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(980): MappedDiff->__construct()
#6 /apps/xmlpipedb/biodb/fall2015/includes/diff/TableDiffFormatter.php(194): WordLevelDiff->__construct()
#7 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(140): TableDiffFormatter->changed()
#8 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(82): DiffFormatter->block()
#9 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(888): DiffFormatter->format()
#10 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(802): DifferenceEngine->generateTextDiffBody()
#11 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(733): DifferenceEngine->generateContentDiffBody()
#12 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(662): DifferenceEngine->getDiffBody()
#13 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(632): DifferenceEngine->getDiff()
#14 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(453): DifferenceEngine->showDiff()
#15 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(795): DifferenceEngine->showDiffPage()
#16 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(506): Article->showDiffPage()
#17 /apps/xmlpipedb/biodb/fall2015/includes/actions/ViewAction.php(44): Article->view()
#18 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(395): ViewAction->show()
#19 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(273): MediaWiki->performAction()
#20 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(566): MediaWiki->performRequest()
#21 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(414): MediaWiki->main()
#22 /apps/xmlpipedb/biodb/fall2015/index.php(44): MediaWiki->run()
#23 {main}