cat ''prokaryote.txt'' | sed "y/atcg/tagc/"
 
  cat ''prokaryote.txt'' | sed "y/atcg/tagc/"
   −
'''Result of Text Processing Commands:''' The Complimentary Strand of the Nucleotide Sequence from ''~dondi/xmlpipedb/data/prokaryote.txt''
+
'''Result of Text Processing Commands:''' The Complimentary Strand of the Nucleotide Sequence (<nowiki>3'-5' direction</nowiki>) from ''~dondi/xmlpipedb/data/prokaryote.txt''
    
  agatgatataaagttatccatgctaccggtttcttctgttataacttgaactttgcaacggattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaattg
 
  agatgatataaagttatccatgctaccggtttcttctgttataacttgaactttgcaacggattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaattg
    
[[Image:ExPASy_Prokaryote.txt_Translation.png|ExPASy Translate Tool Results for prokaryote.txt DNA Sequence - Thank you, [[User:Bklein7|Brandon Klein]], for uploading the image.]]
 
[[Image:ExPASy_Prokaryote.txt_Translation.png|ExPASy Translate Tool Results for prokaryote.txt DNA Sequence - Thank you, [[User:Bklein7|Brandon Klein]], for uploading the image.]]
* '''Note:''' The amino acid sequences that I recovered from using text processing commands (and the Terminal app on my MacBook) are a match to the ExPASy Translate Tool results of the same DNA sequence from the ''prokaryote.txt'' file.
+
* '''Note:''' The amino acid sequences that I recovered from using text processing commands are a match to the ExPASy Translate Tool results of the same DNA sequence from the ''prokaryote.txt'' file.
    
=== XMLPipeDB Match Practice ===
 
=== XMLPipeDB Match Practice ===
 
For your convenience, the XMLPipeDB Match Utility (''xmlpipedb-match-1.1.1.jar'') has been installed in the ''~dondi/xmlpipedb/data'' directory alongside the other practice files. Use this utility to answer the following questions:
 
For your convenience, the XMLPipeDB Match Utility (''xmlpipedb-match-1.1.1.jar'') has been installed in the ''~dondi/xmlpipedb/data'' directory alongside the other practice files. Use this utility to answer the following questions:
   −
# What Match command tallies the occurrences of the pattern <code>GO:000[567]</code> in the ''493.P_falciparum.xml'' file?
+
# What Match command tallies the occurrences of the pattern <code>GO:000[567]</code> in the ''493.P_falciparum.xml'' file? '''java -jar xmlpipedb-match-1.1.1.jar "GO:000[567]" < 493.P_falciparum.xml'''
 
#* How many unique matches are there?
 
#* How many unique matches are there?
 +
#** There are '''3''' unique matches.
 
#* How many times does each unique match appear?
 
#* How many times does each unique match appear?
 +
#** "go:0007" appears '''113''' times. "go:0006" appears '''1100''' times. "go:0005" appears '''1371''' times.
 
# Try to find one such occurrence “in situ” within that file. Look at the neighboring content around that occurrence.
 
# Try to find one such occurrence “in situ” within that file. Look at the neighboring content around that occurrence.
 
#* Describe how you did this.
 
#* Describe how you did this.
 +
#** First, I typed the command "grep "GO:0005" 493.P_falciparum.xml" and it gave me a list that showed similar lines of code: <dbReference type="GO" id="GO:0005....">. I typed the following command "cat 493.P_falciparum.xml" that allowed me to view the entire file, which is a very large file indeed. Then I manually scrolled through the file to find the pattern (lots of scrolling).
 
#* Based on where you find this occurrence, what kind of information does this pattern represent?
 
#* Based on where you find this occurrence, what kind of information does this pattern represent?
Exception encountered, of type "Error"
[691c6975] /biodb/fall2015/index.php?diff=cur&oldid=1413&title=Rlegaspi_Week_3 Error from line 434 of /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php: Call to undefined function each()
Backtrace:
#0 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(544): DiffEngine->diag()
#1 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(344): DiffEngine->compareSeq()
#2 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(227): DiffEngine->diffLocal()
#3 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(721): DiffEngine->diff()
#4 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(859): Diff->__construct()
#5 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(980): MappedDiff->__construct()
#6 /apps/xmlpipedb/biodb/fall2015/includes/diff/TableDiffFormatter.php(194): WordLevelDiff->__construct()
#7 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(140): TableDiffFormatter->changed()
#8 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(111): DiffFormatter->block()
#9 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(888): DiffFormatter->format()
#10 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(802): DifferenceEngine->generateTextDiffBody()
#11 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(733): DifferenceEngine->generateContentDiffBody()
#12 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(662): DifferenceEngine->getDiffBody()
#13 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(632): DifferenceEngine->getDiff()
#14 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(453): DifferenceEngine->showDiff()
#15 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(795): DifferenceEngine->showDiffPage()
#16 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(506): Article->showDiffPage()
#17 /apps/xmlpipedb/biodb/fall2015/includes/actions/ViewAction.php(44): Article->view()
#18 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(395): ViewAction->show()
#19 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(273): MediaWiki->performAction()
#20 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(566): MediaWiki->performRequest()
#21 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(414): MediaWiki->main()
#22 /apps/xmlpipedb/biodb/fall2015/index.php(44): MediaWiki->run()
#23 {main}