|
|
| | cat ''prokaryote.txt'' | sed "y/atcg/tagc/" | | cat ''prokaryote.txt'' | sed "y/atcg/tagc/" |
| | | | |
| − | '''Result of Text Processing Commands:''' The Complimentary Strand of the Nucleotide Sequence from ''~dondi/xmlpipedb/data/prokaryote.txt'' | + | '''Result of Text Processing Commands:''' The Complimentary Strand of the Nucleotide Sequence (<nowiki>3'-5' direction</nowiki>) from ''~dondi/xmlpipedb/data/prokaryote.txt'' |
| | | | |
| | agatgatataaagttatccatgctaccggtttcttctgttataacttgaactttgcaacggattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaattg | | agatgatataaagttatccatgctaccggtttcttctgttataacttgaactttgcaacggattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaattg |
|
|
| | | | |
| | [[Image:ExPASy_Prokaryote.txt_Translation.png|ExPASy Translate Tool Results for prokaryote.txt DNA Sequence - Thank you, [[User:Bklein7|Brandon Klein]], for uploading the image.]] | | [[Image:ExPASy_Prokaryote.txt_Translation.png|ExPASy Translate Tool Results for prokaryote.txt DNA Sequence - Thank you, [[User:Bklein7|Brandon Klein]], for uploading the image.]] |
| − | * '''Note:''' The amino acid sequences that I recovered from using text processing commands (and the Terminal app on my MacBook) are a match to the ExPASy Translate Tool results of the same DNA sequence from the ''prokaryote.txt'' file. | + | * '''Note:''' The amino acid sequences that I recovered from using text processing commands are a match to the ExPASy Translate Tool results of the same DNA sequence from the ''prokaryote.txt'' file. |
| | | | |
| | === XMLPipeDB Match Practice === | | === XMLPipeDB Match Practice === |
|
|
| | For your convenience, the XMLPipeDB Match Utility (''xmlpipedb-match-1.1.1.jar'') has been installed in the ''~dondi/xmlpipedb/data'' directory alongside the other practice files. Use this utility to answer the following questions: | | For your convenience, the XMLPipeDB Match Utility (''xmlpipedb-match-1.1.1.jar'') has been installed in the ''~dondi/xmlpipedb/data'' directory alongside the other practice files. Use this utility to answer the following questions: |
| | | | |
| − | # What Match command tallies the occurrences of the pattern <code>GO:000[567]</code> in the ''493.P_falciparum.xml'' file? | + | # What Match command tallies the occurrences of the pattern <code>GO:000[567]</code> in the ''493.P_falciparum.xml'' file? '''java -jar xmlpipedb-match-1.1.1.jar "GO:000[567]" < 493.P_falciparum.xml''' |
| | #* How many unique matches are there? | | #* How many unique matches are there? |
| | + | #** There are '''3''' unique matches. |
| | #* How many times does each unique match appear? | | #* How many times does each unique match appear? |
| | + | #** "go:0007" appears '''113''' times. "go:0006" appears '''1100''' times. "go:0005" appears '''1371''' times. |
| | # Try to find one such occurrence “in situ” within that file. Look at the neighboring content around that occurrence. | | # Try to find one such occurrence “in situ” within that file. Look at the neighboring content around that occurrence. |
| | #* Describe how you did this. | | #* Describe how you did this. |
| | + | #** First, I typed the command "grep "GO:0005" 493.P_falciparum.xml" and it gave me a list that showed similar lines of code: <dbReference type="GO" id="GO:0005....">. I typed the following command "cat 493.P_falciparum.xml" that allowed me to view the entire file, which is a very large file indeed. Then I manually scrolled through the file to find the pattern (lots of scrolling). |
| | #* Based on where you find this occurrence, what kind of information does this pattern represent? | | #* Based on where you find this occurrence, what kind of information does this pattern represent? |
Exception encountered, of type "Error"
[270f4926] /biodb/fall2015/index.php?diff=cur&oldid=1413&title=Rlegaspi_Week_3 Error from line 434 of /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php: Call to undefined function each()
Backtrace:
#0 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(544): DiffEngine->diag()
#1 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(344): DiffEngine->compareSeq()
#2 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(227): DiffEngine->diffLocal()
#3 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(721): DiffEngine->diff()
#4 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(859): Diff->__construct()
#5 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(980): MappedDiff->__construct()
#6 /apps/xmlpipedb/biodb/fall2015/includes/diff/TableDiffFormatter.php(194): WordLevelDiff->__construct()
#7 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(140): TableDiffFormatter->changed()
#8 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(111): DiffFormatter->block()
#9 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(888): DiffFormatter->format()
#10 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(802): DifferenceEngine->generateTextDiffBody()
#11 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(733): DifferenceEngine->generateContentDiffBody()
#12 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(662): DifferenceEngine->getDiffBody()
#13 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(632): DifferenceEngine->getDiff()
#14 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(453): DifferenceEngine->showDiff()
#15 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(795): DifferenceEngine->showDiffPage()
#16 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(506): Article->showDiffPage()
#17 /apps/xmlpipedb/biodb/fall2015/includes/actions/ViewAction.php(44): Article->view()
#18 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(395): ViewAction->show()
#19 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(273): MediaWiki->performAction()
#20 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(566): MediaWiki->performRequest()
#21 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(414): MediaWiki->main()
#22 /apps/xmlpipedb/biodb/fall2015/index.php(44): MediaWiki->run()
#23 {main}