|
|
| | | | |
| | == The Genetic Code, by computer == | | == The Genetic Code, by computer == |
| | + | First, login to the LMU CS server using ssh. Type in the following in a command prompt (Windows) or terminal (Mac) window: |
| | + | ssh <username@my.cs.lmu.edu> |
| | + | Enter your password. Note: You will not visibly see the cursor move when typing in your password so just keep typing. |
| | + | Then change directories to dondi's using the following commands to find the practice files and other miscellaneous files: |
| | + | cd ~dondi/xmlpipedb/data |
| | + | Here, you can use the command <code>ls</code> in order to see the list of files in the directory. Then we can start manipulating some files. |
| | + | |
| | + | |
| | === Complement of DNA === | | === Complement of DNA === |
| | To find the complementary strand when given a standard 5' to 3' DNA strand, match each of the four base pairs A,T,C, and G with T, A, G, and C, respectively. Done in the computer, we use the ''sed'' command for replacing the bases with the ones they correspond to. | | To find the complementary strand when given a standard 5' to 3' DNA strand, match each of the four base pairs A,T,C, and G with T, A, G, and C, respectively. Done in the computer, we use the ''sed'' command for replacing the bases with the ones they correspond to. |
| − | To find the complement of the DNA strand, the following command is used: | + | To find the complement of the DNA strand in the file ''prokaryote.txt'', the following command is used: |
| | Command: sed "y/actg/tgac/" prokaryote.txt | | Command: sed "y/actg/tgac/" prokaryote.txt |
| | Yields: agatgatataaagttatccatgctaccggtttcttctgttataacttgaactttgcaacggattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaattg | | Yields: agatgatataaagttatccatgctaccggtttcttctgttataacttgaactttgcaacggattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaattg |
|
|
| | | | |
| | In tallying the number of occurrences of <code>ATG</code> in ''hs_ref_GRCh37_chr19.fa'': | | In tallying the number of occurrences of <code>ATG</code> in ''hs_ref_GRCh37_chr19.fa'': |
Exception encountered, of type "Error"
[711e9cbe] /biodb/fall2015/index.php?diff=cur&oldid=1591&title=Troque_Week_3 Error from line 434 of /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php: Call to undefined function each()
Backtrace:
#0 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(544): DiffEngine->diag()
#1 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(344): DiffEngine->compareSeq()
#2 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(227): DiffEngine->diffLocal()
#3 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(721): DiffEngine->diff()
#4 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(859): Diff->__construct()
#5 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(980): MappedDiff->__construct()
#6 /apps/xmlpipedb/biodb/fall2015/includes/diff/TableDiffFormatter.php(194): WordLevelDiff->__construct()
#7 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(140): TableDiffFormatter->changed()
#8 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(82): DiffFormatter->block()
#9 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(888): DiffFormatter->format()
#10 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(802): DifferenceEngine->generateTextDiffBody()
#11 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(733): DifferenceEngine->generateContentDiffBody()
#12 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(662): DifferenceEngine->getDiffBody()
#13 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(632): DifferenceEngine->getDiff()
#14 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(453): DifferenceEngine->showDiff()
#15 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(795): DifferenceEngine->showDiffPage()
#16 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(506): Article->showDiffPage()
#17 /apps/xmlpipedb/biodb/fall2015/includes/actions/ViewAction.php(44): Article->view()
#18 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(395): ViewAction->show()
#19 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(273): MediaWiki->performAction()
#20 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(566): MediaWiki->performRequest()
#21 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(414): MediaWiki->main()
#22 /apps/xmlpipedb/biodb/fall2015/index.php(44): MediaWiki->run()
#23 {main}