Difference between revisions of "Kevin Wyllie Week 2"
From LMU BioDB 2015
(I have begun the Week 2 Journal Assignment and am just saving in case my connection times out or something like that.) |
(Again, just saving my progress so that I don't lose any work.) |
||
| Line 1: | Line 1: | ||
=== Week 2 Journal === | === Week 2 Journal === | ||
| − | The | + | The given DNA sequence is written in the top strand, while its complementary strand is shown below it. |
| − | + | ||
| − | 3'- | + | 5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' |
| + | 3'-gc ata cga tta tgg tac aag gcg cat att ggg tcg gcg gtc aag gcg acc gcc gta aaa t- 5' | ||
Translated reading frames: | Translated reading frames: | ||
| − | * '''+1''' R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L '''( | + | * '''+1''' R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L '''(This is an open reading frame)''' |
| − | * '''+2''' V-C | + | * '''+2''' V-C |
| − | * '''+3''' Y-A-N-T-M-F-R-V ''' | + | * '''+3''' Y-A-N-T-M-F-R-V |
| + | * '''-1''' The first codon in this reading frame is a STOP codon. | ||
| + | * '''-2''' K-M-P-P-A-E-L-A-A-G | ||
| + | * '''-3''' | ||
| + | |||
| + | |||
| + | 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5' | ||
Revision as of 04:12, 14 September 2015
Week 2 Journal
The given DNA sequence is written in the top strand, while its complementary strand is shown below it.
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' 3'-gc ata cga tta tgg tac aag gcg cat att ggg tcg gcg gtc aag gcg acc gcc gta aaa t- 5'
Translated reading frames:
- +1 R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (This is an open reading frame)
- +2 V-C
- +3 Y-A-N-T-M-F-R-V
- -1 The first codon in this reading frame is a STOP codon.
- -2 K-M-P-P-A-E-L-A-A-G
- -3
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'
