Difference between revisions of "Kevin Wyllie Week 2"

Revision as of 04:38, 14 September 2015

The given DNA sequence is written in the top strand, while its complementary strand is shown below it.

5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3'
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'

Translated reading frames:

+1 R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (This is an open reading frame.)
+2 V-C
+3 Y-A-N-T-M-F-R-V
-1 The first codon in this reading frame is a STOP codon.
-2 K-M-P-P-A-E-L-A-A-G
-3 K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (This is an open reading frame.)Kwyllie User Page

@@ Line 1: / Line 1: @@
-=== Week 2 Journal ===
+=== Kwyllie Week 2 ===
 The given DNA sequence is written in the top strand, while its complementary strand is shown below it.
@@ Line 5: / Line 5: @@
 '- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3'
-'-gc ata cga tta tgg tac aag gcg cat att ggg tcg gcg gtc aag gcg acc gcc gta aaa t- 5'
+'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'
 Translated reading frames:
-* '''+1'''  R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L '''(This is an open reading frame)'''
+* '''+1'''  R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L '''(This is an open reading frame.)'''
 * '''+2'''  V-C
 * '''+3'''  Y-A-N-T-M-F-R-V
 * '''-1'''  The first codon in this reading frame is a STOP codon.
 * '''-2'''  K-M-P-P-A-E-L-A-A-G
-* '''-3'''
+* '''-3'''  K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y '''(This is an open reading frame.)'''
-'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'
+[[Category:Journal Entry]]
+[[Kwyllie User Page]]