Difference between revisions of "Kevin Wyllie Week 2"

From LMU BioDB 2015
Jump to: navigation, search
(I finished up the individual journal assignment.)
(I fixed the link to my user page.)
Line 18: Line 18:
  
 
[[Category:Journal Entry]]
 
[[Category:Journal Entry]]
[[Kwyllie User Page]]
+
[[User:Kwyllie]]

Revision as of 04:40, 14 September 2015

Kwyllie Week 2

The given DNA sequence is written in the top strand, while its complementary strand is shown below it.


5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3'
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'


Translated reading frames:

  • +1 R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (This is an open reading frame.)
  • +2 V-C
  • +3 Y-A-N-T-M-F-R-V
  • -1 The first codon in this reading frame is a STOP codon.
  • -2 K-M-P-P-A-E-L-A-A-G
  • -3 K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (This is an open reading frame.)User:Kwyllie