Difference between revisions of "Kevin Wyllie Week 2"
From LMU BioDB 2015
(I fixed the link to my user page.) |
(Another attempt to fix the link to my user page.) |
||
Line 18: | Line 18: | ||
[[Category:Journal Entry]] | [[Category:Journal Entry]] | ||
+ | |||
+ | |||
[[User:Kwyllie]] | [[User:Kwyllie]] |
Revision as of 04:40, 14 September 2015
Kwyllie Week 2
The given DNA sequence is written in the top strand, while its complementary strand is shown below it.
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'
Translated reading frames:
- +1 R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (This is an open reading frame.)
- +2 V-C
- +3 Y-A-N-T-M-F-R-V
- -1 The first codon in this reading frame is a STOP codon.
- -2 K-M-P-P-A-E-L-A-A-G
- -3 K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (This is an open reading frame.)User:Kwyllie