Difference between revisions of "Kevin Wyllie Week 2"
From LMU BioDB 2015
(I fixed some syntax errors.) |
(I fixed some minor formatting issues.) |
||
| Line 4: | Line 4: | ||
| − | 5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' | + | 5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' |
| − | 3'- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5' | + | 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5' |
Revision as of 04:42, 14 September 2015
Journal Week 2
The given DNA sequence is written in the top strand, while its complementary strand is shown below it.
5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'
Translated reading frames:
- +1 R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (This is an open reading frame.)
- +2 V-C
- +3 Y-A-N-T-M-F-R-V
- -1 The first codon in this reading frame is a STOP codon.
- -2 K-M-P-P-A-E-L-A-A-G
- -3 K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (This is an open reading frame.)
