Difference between revisions of "Vpachec3 Week 4"

Revision as of 23:35, 26 September 2015

My lab partner, Nicole, was a big help and helped me go through the Week 4 homework. Here is how far we got:

vpachec3@ab201:/nfs/home/dondi/xmlpipedb/data$ cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/ <minus35box>& <\/minus35box> /1"|sed "s/[ct]at[at]at/ <minus10box>& <\/minus10box> /2"

This is what the command gave us:

 ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact </minus35box> tatttacagaacttcgg <minus10box>cattat </minus10box>     cttgccggttcaaattacggtagtgataccccagaggattagatggccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat

Right before we were stopped to bring it back into a larger group discussion, Nicole taught me that \n would break it into two lines. We just didn't get to apply it to the command line just yet.

Now trying this on my own. I used the \n to break the line to start to figure out how to add the transcription start site. I wanted to break the information into two line so i used this command:

cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>& <\/minus35box> /1" |sed "s/[ct]at[at]at/ <minus10box>& <\/minus10box> /2"| sed "s/ <minus10box>/& \n/g"

However, I wanted to break the line after the minus 10 box so I modified the command:

cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>& <\/minus35box> /1" |sed "s/[ct]at[at]at/ <minus10box>& <\/minus10box> /2"| sed "s/ <\/minus10box> /&\n/g"

This command gave me:

ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc <minus35box>tttact </minus35box> tatttacagaacttcgg <minus10box>cattat </minus10box> 

cttgccggttcaaattacggtagtgataccccagaggattagatggccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat

Breaking it into two lines would be easier to insert the transcription start site because we were told:The transcription start site is located at the 12th nucleotide after the first nucleotide of the -10 box.

This means that I could count to insert the transcription start site and use commands that I have used before to insert the tag.

Links

Vpachec3 User Page