Difference between revisions of "Kevin Wyllie Week 4"

From LMU BioDB 2015
Jump to: navigation, search
(Added a screenshot for the first pipe.)
(Added the answer, in text, for question 1.)
Line 2: Line 2:
  
 
===Adding Tags for Each Gene "Landmark"===
 
===Adding Tags for Each Gene "Landmark"===
 +
 +
====Question 1====
  
 
  cat infA-E.coli-K12.txt | '''sed -r "s/tt[gt]ac[at](.){17}[ct]at[at]at/ <minus35box>&<\/minus10box> /g"'''
 
  cat infA-E.coli-K12.txt | '''sed -r "s/tt[gt]ac[at](.){17}[ct]at[at]at/ <minus35box>&<\/minus10box> /g"'''
Line 11: Line 13:
 
...and these sed commands add the remaining tags for the -35 and -10 box, based on the location of either existing tag.
 
...and these sed commands add the remaining tags for the -35 and -10 box, based on the location of either existing tag.
  
  cat infA-E.coli-K12.txt | ... | '''sed -r "s/[ct]at[at]at<\/minus10box>(.){6}/& <tss>/g" | sed "s/<tss>./&<\/tss> /g"'''
+
cat infA-E.coli-K12.txt | ... | '''sed -r "s/[ct]at[at]at<\/minus10box>(.){6}/& <tss>/g" | sed "s/<tss>./&<\/tss> /g"'''
  
 
These commands add the tags for the transcription start site (TSS), based on its consensus sequence and known distance from the -10 box.  
 
These commands add the tags for the transcription start site (TSS), based on its consensus sequence and known distance from the -10 box.  
Line 40: Line 42:
  
  
The final pipe is shown entered into the command line, along with the output.
+
*The final pipe is shown entered into the command line, along with the output.
  
 
[[image:KwWeek4screenshot1.jpg|right|thumb]]
 
[[image:KwWeek4screenshot1.jpg|right|thumb]]
 +
 +
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgat ttagcgcgcaaatc <minus35box>tttact</minus35box> tatttacagaacttcgg <minus10box>cattat</minus10box> cttgc <tss>c</tss> ggttcaaattacggtagtgatacccca <rbs>gagg</rbs> attag <start_codon>atg</start_codon> gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccg tagtcgctgattgttttaccgcc <stop_codon>tga</stop_codon> tgggcgaagagaaagaacgagt <terminator>aaaaggtcggtttaaccggcctttttatt</terminator> ttat
 +
 +
 +
 +
====Question 2====

Revision as of 04:00, 29 September 2015

Transcription and Translation “Taken to the Next Level”

Adding Tags for Each Gene "Landmark"

Question 1

cat infA-E.coli-K12.txt | sed -r "s/tt[gt]ac[at](.){17}[ct]at[at]at/ <minus35box>&<\/minus10box> /g"

The sed command shown finds the beginning tag for the -35 box and the end tag for the -10 box, based on their consensus sequence and known distance from each other...

cat infA-E.coli-K12.txt | sed -r "s/tt[gt]ac[at](.){17}[ct]at[at]at/ <minus35box>&<\/minus10box> /g" | sed "s/<minus35box>tt[gt]ac[at]/&<\/minus35box> /g" | sed "s/[ct]at[at]at<\/minus10box>/ <minus10box>&/g"

...and these sed commands add the remaining tags for the -35 and -10 box, based on the location of either existing tag.

cat infA-E.coli-K12.txt | ... | sed -r "s/[ct]at[at]at<\/minus10box>(.){6}/& <tss>/g" | sed "s/<tss>./&<\/tss> /g"

These commands add the tags for the transcription start site (TSS), based on its consensus sequence and known distance from the -10 box.

cat infA-E.coli-K12.txt | ... | sed "s/gagg/ <rbs>&<\/rbs> /g"

This sed command adds the ribosome binding site (RBS), based its consensus sequence.

cat infA-E.coli-K12.txt | ... | sed "s/aaaaggt/ <terminator>&/g" | sed "s/gcctttt…./&<\/terminator> /g"

This sed command adds the tags for the terminator, based off of its consensus sequence and hairpin behavior.

cat infA-E.coli-K12.txt | ... | sed "s/<\/rbs> /&\n/g" | sed "2s/atg/ <start_codon>&<\/start_codon> /1"

These commands start a new line after the RBS and then add start-codon tags to the first occurring "atg" sequence on the newly separated line.

cat infA-E.coli-K12.txt | ... | sed "2s/ta[ag]/\n&/g" | sed "3,10s/tga/\n&/g"

These commands start a new line for each potential stop codon sequence occurring after the RBS.

cat infA-E.coli-K12.txt | ... | sed "17s/tga/ <stop_codon>&<\/stop_codon> /g"

These commands at stop-codon tags to the potential stop codon sequence occurring closest to (but not after) the terminator.

cat infA-E.coli-K12.txt | ... | sed ':a;N;$!ba;s/\n//g'

This rather unintelligible command undoes any line breaks, combining the text file back into one line.


  • The final pipe is shown entered into the command line, along with the output.
KwWeek4screenshot1.jpg

ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgat ttagcgcgcaaatc <minus35box>tttact</minus35box> tatttacagaacttcgg <minus10box>cattat</minus10box> cttgc <tss>c</tss> ggttcaaattacggtagtgatacccca <rbs>gagg</rbs> attag <start_codon>atg</start_codon> gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccg tagtcgctgattgttttaccgcc <stop_codon>tga</stop_codon> tgggcgaagagaaagaacgagt <terminator>aaaaggtcggtttaaccggcctttttatt</terminator> ttat


Question 2