|
|
| | === -35 box and -10 box === | | === -35 box and -10 box === |
| | Firstly, we were able to learn the placement of possible -35 box and -10 box locations in the sequence and how to "tag" these special sequences. We were able to search for both of the special sequences concurrently with the knowledge that the sequence for a -35 box is <code>tt[gt]ac[at]</code> and the sequence for a -10 box is <code>[ct]at[at]at</code>. We could have used <code>grep</code> to search for the sequences individually, but to see where the potential locations for both -35 box and -10 box we used the following command: | | Firstly, we were able to learn the placement of possible -35 box and -10 box locations in the sequence and how to "tag" these special sequences. We were able to search for both of the special sequences concurrently with the knowledge that the sequence for a -35 box is <code>tt[gt]ac[at]</code> and the sequence for a -10 box is <code>[ct]at[at]at</code>. We could have used <code>grep</code> to search for the sequences individually, but to see where the potential locations for both -35 box and -10 box we used the following command: |
| − | '''cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ *&* /g" | sed "s/[ct]at[at]at/ **&** /g"''' | + | cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ *&* /g" | sed "s/[ct]at[at]at/ **&** /g" |
| | ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgt **tataat** tgcggtcgcagagttggttacgct | | ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgt **tataat** tgcggtcgcagagttggttacgct |
| | cattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgtt | | cattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgtt |
|
|
| | ggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat | | ggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat |
| | After finding the locations of the potential -35 box and -10 box locations, it was clear where the '''actual''' -35 box and '''actual''' -10 box were (the first instance of the sequence for the -35 box and the second instance of the sequence for the -10 box). To ensure that we would only be highlighting the '''actual''' -35 box and -10 box sequences, all we need to do is replace the "g" in <code>sed "s///g"</code> with a "1" or "2" or the desired instance. This tells <code>sed</code> to replace the instance we desire, which is what was described in the [[More Text Processing Features]] page. The resulting command would produce the following result: | | After finding the locations of the potential -35 box and -10 box locations, it was clear where the '''actual''' -35 box and '''actual''' -10 box were (the first instance of the sequence for the -35 box and the second instance of the sequence for the -10 box). To ensure that we would only be highlighting the '''actual''' -35 box and -10 box sequences, all we need to do is replace the "g" in <code>sed "s///g"</code> with a "1" or "2" or the desired instance. This tells <code>sed</code> to replace the instance we desire, which is what was described in the [[More Text Processing Features]] page. The resulting command would produce the following result: |
| − | '''cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box> /1" | sed "s/[ct]at[at]at/ <minus10box>&<\/minus10box> /2"''' | + | cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box> /1" | |
| | + | sed "s/[ct]at[at]at/ <minus10box>&<\/minus10box> /2" |
| | ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattacccc | | ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattacccc |
| | gctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttag | | gctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttag |
|
|
| | | | |
| | After finding and tagging the -35 and -10 box, the assignment required us to highlight the transcription start site (TSS), which is the twelfth nucleotide after the first nucleotide in the -10 box. Therefore, I could infer that the character 7 nucleotides after the end of the -10 box tag is the TSS because the -10 box sequence is 6 nucleotides long. In order to find the TSS with command sequences, I will need to create a new line using a technique described in [[More Text Processing Features]]. With the technique, I will tag the TSS in line 2 which will be the first nucleotide on the line. | | After finding and tagging the -35 and -10 box, the assignment required us to highlight the transcription start site (TSS), which is the twelfth nucleotide after the first nucleotide in the -10 box. Therefore, I could infer that the character 7 nucleotides after the end of the -10 box tag is the TSS because the -10 box sequence is 6 nucleotides long. In order to find the TSS with command sequences, I will need to create a new line using a technique described in [[More Text Processing Features]]. With the technique, I will tag the TSS in line 2 which will be the first nucleotide on the line. |
Exception encountered, of type "Error"
[c2697485] /biodb/fall2015/index.php?diff=next&oldid=1988&title=Rlegaspi_Week_4 Error from line 434 of /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php: Call to undefined function each()
Backtrace:
#0 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(544): DiffEngine->diag()
#1 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(344): DiffEngine->compareSeq()
#2 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(227): DiffEngine->diffLocal()
#3 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(721): DiffEngine->diff()
#4 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(859): Diff->__construct()
#5 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(980): MappedDiff->__construct()
#6 /apps/xmlpipedb/biodb/fall2015/includes/diff/TableDiffFormatter.php(194): WordLevelDiff->__construct()
#7 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(140): TableDiffFormatter->changed()
#8 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(82): DiffFormatter->block()
#9 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(888): DiffFormatter->format()
#10 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(802): DifferenceEngine->generateTextDiffBody()
#11 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(733): DifferenceEngine->generateContentDiffBody()
#12 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(662): DifferenceEngine->getDiffBody()
#13 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(632): DifferenceEngine->getDiff()
#14 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(453): DifferenceEngine->showDiff()
#15 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(795): DifferenceEngine->showDiffPage()
#16 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(506): Article->showDiffPage()
#17 /apps/xmlpipedb/biodb/fall2015/includes/actions/ViewAction.php(44): Article->view()
#18 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(395): ViewAction->show()
#19 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(273): MediaWiki->performAction()
#20 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(566): MediaWiki->performRequest()
#21 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(414): MediaWiki->main()
#22 /apps/xmlpipedb/biodb/fall2015/index.php(44): MediaWiki->run()
#23 {main}