Difference between revisions of "Kevin Wyllie Week 2"
From LMU BioDB 2015
(I fixed some minor formatting issues.) |
(I went ahead and added the "Nter" and "Cter" notation just for explicit clarity.) |
||
| Line 5: | Line 5: | ||
5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' | 5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' | ||
| − | 3'- | + | 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaa t- 5' |
Translated reading frames: | Translated reading frames: | ||
| − | * '''+1''' R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L '''(This is an open reading frame.)''' | + | * '''+1''' Nter-R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-Cter '''(This is an open reading frame.)''' |
| − | * '''+2''' V-C | + | * '''+2''' Nter-V-C-Cter |
| − | * '''+3''' Y-A-N-T-M-F-R-V | + | * '''+3''' Nter-Y-A-N-T-M-F-R-V-Cter |
| − | * '''-1''' The first codon in this reading frame is a STOP codon. | + | * '''-1''' The first codon in this reading frame is a STOP codon, so there is no polypeptide. |
| − | * '''-2''' K-M-P-P-A-E-L-A-A-G | + | * '''-2''' Nter-K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I-Cter '''(This is an open reading frame.)''' |
| − | * '''-3''' K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y '''(This is an open reading frame.)''' | + | * '''-3''' Nter-K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y-Cter '''(This is an open reading frame.)''' |
Revision as of 03:31, 15 September 2015
Journal Week 2
The given DNA sequence is written in the top strand, while its complementary strand is shown below it.
5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaa t- 5'
Translated reading frames:
- +1 Nter-R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-Cter (This is an open reading frame.)
- +2 Nter-V-C-Cter
- +3 Nter-Y-A-N-T-M-F-R-V-Cter
- -1 The first codon in this reading frame is a STOP codon, so there is no polypeptide.
- -2 Nter-K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I-Cter (This is an open reading frame.)
- -3 Nter-K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y-Cter (This is an open reading frame.)
