cat ''prokaryote.txt'' | sed "y/atcg/tagc/"
 
  cat ''prokaryote.txt'' | sed "y/atcg/tagc/"
   −
'''Result of Text Processing Commands:''' The Complimentary Strand of the Nucleotide Sequence from ''~dondi/xmlpipedb/data/prokaryote.txt''
+
'''Result of Text Processing Commands:''' The Complimentary Strand of the Nucleotide Sequence (<nowiki>3'-5' direction</nowiki>) from ''~dondi/xmlpipedb/data/prokaryote.txt''
    
  agatgatataaagttatccatgctaccggtttcttctgttataacttgaactttgcaacggattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaattg
 
  agatgatataaagttatccatgctaccggtttcttctgttataacttgaactttgcaacggattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaattg
    
# To complete the first part of '''The Genetic Code, by Computer''' ('''Complement of a Strand'''), I firstly had to connect to the ''my.cs.lmu.edu'' work station on my MacBook Pro laptop. Thankfully, my homework partner [[User:Kwyllie | Kevin]]<br> told me in class that we need to be connected to the LMU network [i.e. '''Student(Secure)'''], which saved a lot of frustration because I was planning to work from home. I do understand that it is required to connect via LMU network because the computer that operates the ''my.cs.lmu.edu'' is on campus. Focusing more on the assignment, I found it useful to write my thoughts out on paper before using my Terminal app and ''my.cs.lmu.edu'' work station. I chose the shortest of the two practice files. When thinking about complimentary strand of the DNA sequence, I figured that all of the nucleotides needed to be changed into their compliments ('''a''' to '''t''', '''t''' to '''a''', '''c''' to '''g''', '''g''' to '''c'''). From the Tuesday Dondi lecture, I remember the command used to replace characters into desired characters - '''sed "y/  /  /"'''. The piped text processing commands of '''cat prokaryote.txt | sed "y/atcg/tagc/"''' produced the expected output that I wanted, which was the compliment strand.
 
# To complete the first part of '''The Genetic Code, by Computer''' ('''Complement of a Strand'''), I firstly had to connect to the ''my.cs.lmu.edu'' work station on my MacBook Pro laptop. Thankfully, my homework partner [[User:Kwyllie | Kevin]]<br> told me in class that we need to be connected to the LMU network [i.e. '''Student(Secure)'''], which saved a lot of frustration because I was planning to work from home. I do understand that it is required to connect via LMU network because the computer that operates the ''my.cs.lmu.edu'' is on campus. Focusing more on the assignment, I found it useful to write my thoughts out on paper before using my Terminal app and ''my.cs.lmu.edu'' work station. I chose the shortest of the two practice files. When thinking about complimentary strand of the DNA sequence, I figured that all of the nucleotides needed to be changed into their compliments ('''a''' to '''t''', '''t''' to '''a''', '''c''' to '''g''', '''g''' to '''c'''). From the Tuesday Dondi lecture, I remember the command used to replace characters into desired characters - '''sed "y/  /  /"'''. The piped text processing commands of '''cat prokaryote.txt | sed "y/atcg/tagc/"''' produced the expected output that I wanted, which was the compliment strand.
Exception encountered, of type "Error"
[8ed7cdb4] /biodb/fall2015/index.php?diff=prev&oldid=1414&title=Rlegaspi_Week_3 Error from line 434 of /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php: Call to undefined function each()
Backtrace:
#0 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(544): DiffEngine->diag()
#1 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(344): DiffEngine->compareSeq()
#2 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(227): DiffEngine->diffLocal()
#3 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(721): DiffEngine->diff()
#4 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(859): Diff->__construct()
#5 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(980): MappedDiff->__construct()
#6 /apps/xmlpipedb/biodb/fall2015/includes/diff/TableDiffFormatter.php(194): WordLevelDiff->__construct()
#7 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(140): TableDiffFormatter->changed()
#8 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(111): DiffFormatter->block()
#9 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(888): DiffFormatter->format()
#10 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(802): DifferenceEngine->generateTextDiffBody()
#11 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(733): DifferenceEngine->generateContentDiffBody()
#12 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(662): DifferenceEngine->getDiffBody()
#13 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(632): DifferenceEngine->getDiff()
#14 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(453): DifferenceEngine->showDiff()
#15 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(795): DifferenceEngine->showDiffPage()
#16 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(506): Article->showDiffPage()
#17 /apps/xmlpipedb/biodb/fall2015/includes/actions/ViewAction.php(44): Article->view()
#18 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(395): ViewAction->show()
#19 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(273): MediaWiki->performAction()
#20 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(566): MediaWiki->performRequest()
#21 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(414): MediaWiki->main()
#22 /apps/xmlpipedb/biodb/fall2015/index.php(44): MediaWiki->run()
#23 {main}