Difference between revisions of "Emilysimso Week 4"

Latest revision as of 22:41, 26 September 2015

Used grep "[ct]at[at]at" infA-E.coli-K12.txt to highlight the -10box
Used grep "tt[gt]ac[at]" infA-E.coli-K12.txt to highlight the -35 box
Used sed "s/cattat/<minus10box>&<\/minus10box>/g" infA-E.coli-K12.txt | sed "s/tttact/<minus35box>&<\/minus35box>/g" to add the labels to the -35box and -10box

Added sed -r "s/<\/minus10box>.{11}/<tss>&<\/tss>/g"
- This did not work because the <tss> label got added before the </minus10box>

Used sed -r "s/<\/minus10box>.{5}/&<\/tss>/g" | sed "s/<\/tss>/<tss>c&/g" to add the tss site markers

Used grep "atg" to find possible start codons
Added sed -r "s/<\/rbs>.{8}/&<\/startcodon>/g" | sed "s/<\/startcodon>/<startcodon>atg&/g" to mark the start codon (atg)

Possible stop codons - taa, tag, or tga
Used sed "s/.../ & /g" infA-E.coli-K12.txt | grep "taa" | grep "tag" | grep "tga" to find possible stop codons
- tga is only possible stop codon
Added sed "1s/tga/<stop_codon>&<\/stop_codon>/g"
- Looked for first one after the start codon
Added sed "1s/tga/<stop_codon>&<\/stop_codon>/3"

Used sed "s/aaaaggt/<terminator>&/g" to mark the first part of the terminator
Used grep "gcctttt" infA-E.coli-K12.txt to find the rest of the hairpin
- Looked for next four bases - they were tatt
Used sed "s/gcctttttatt/&<\/terminator>/g" to mark the end of the terminator

Final command: sed "s/cattat/<minus10box>&<\/minus10box>/g" infA-E.coli-K12.txt | sed "s/tttact/<minus35box>&<\/minus35box>/g" | sed -r "s/<\/minus10box>.{5}/&<\/tss>/g" | sed "s/<\/tss>/<tss>c&/g" | sed "s/gagg/<rbs>&<\/rbs>/g" | sed -r "s/<\/rbs>.{8}/&<\/start_codon>/g" | sed "s/<\/start_codon>/<startcodon>atg&/g" | sed "1s/tga/<stop_codon>&<\/stop_codon>/3" | sed "s/aaaaggt/<terminator>&/g" | sed "s/gcctttttatt/&<\/terminator>/g"
Final result: ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc<minus35box>tttact</minus35box>tatttacagaacttcgg<minus10box>cattat</minus10box>cttgc<tss>c</tss>cggttcaaattacggtagtgatacccca<rbs>gagg</rbs>attagatg<startcodon>atg</start_codon>gccaaagaagacaatat<stop_codon>tga</stop_codon>aatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagt<terminator>aaaaggtcggtttaaccggcctttttatt</terminator>ttat

Took the strand from the tss to the end of the terminator
Used sed "y/atcg/uagc/"
Resulting sequence: ggccaaguuuaaugccaucacuauggggucuccuaaucuacuaccgguuucuucuguuauaacuuuacguuccauggcaagaacuuugcaacggauuaugguacaaggcgcaucucaaucuuuugccagugcaccaaugacguguguagaggccauuuuacgcguuuuugauguaggcguaggacugcccgcuguuucacugacaacuugacuggggcaugcuggacucguuuccggcguaacagaaggcaucagcgacuaacaaaauggcggacuacccgcuucucuuucuugcucauuuuccagccaaauuggccggaaaaauaa

Used "sed "s/.../ & /g" to separate the sequence from Question 2 into codons
Added sed -f genetic-code.sed
Entered answer from Question 2 into type-able space
Resulting sequence: G Q V - C H H Y G V S - S T T G F F C Y N F T F H G K N F A T D Y G T R R I S I F C Q C T N D V C R G H F T R F - C R R R T A R C F T D N L T G A C W T R F R R N R R H Q R L T K W R T T R F S F L L I F Q P N W P E K -

@@ Line 40: / Line 40: @@
 * Entered answer from Question 2 into type-able space
 * Resulting sequence: G  Q  V  -  C  H  H  Y  G  V  S  -  S  T  T  G  F  F  C  Y  N  F  T  F  H  G  K  N  F  A  T  D  Y  G  T  R  R  I  S  I  F  C  Q  C  T  N  D  V  C  R  G  H  F  T  R  F  -  C  R  R  R  T  A  R  C  F  T  D  N  L  T  G  A  C  W  T  R  F  R  R  N  R  R  H  Q  R  L  T  K  W  R  T  T  R  F  S  F  L  L  I  F  Q  P  N  W  P  E  K  -
+{{Template: Esimso entries etc}}