* What is the ''exact'' mRNA sequence that is transcribed from this gene?
 
* What is the ''exact'' mRNA sequence that is transcribed from this gene?
**In order to get the mRNA sequence I need to get the sequence between the transcription start site and the terminator.  I found it easiest to make new lines based on the mark up tags already there.  From that point I can pick and choose which lines I need to transcribe.  Using sed, I can delete lines.  Example:  <code> sed "2,4D"</code>  So, using this trick, I deleted all unnecessary lines.  From there all nucleotides not deleted should be transcribed into mRNA.  I was going to make new lines using by typing out a bunch of different sed commands for each different tag, but I can do it simply by using two.  This puts each tag on its own line: <code> sed "s/>/&\n/g" | sed "s/</\n&/g"</code>.  Now I go through, delete the tags and the useless sequences, and transcribe.  Here is the sequence followed by the command.
+
**In order to get the mRNA sequence I need to get the sequence between the transcription start site and the terminator.  I found it easiest to make new lines based on the mark up tags already there.  From that point I can pick and choose which lines I need to transcribe.  Using sed, I can delete lines.  Example:  <code> sed "2,4D"</code>  So, using this trick, I deleted all unnecessary lines.  From there all nucleotides not deleted should be transcribed into mRNA.  I was going to make new lines using by typing out a bunch of different sed commands for each different tag, but I can do it simply by using two.  This puts each tag on its own line: <code> sed "s/>/&\n/g" | sed "s/</\n&/g"</code>.  Now I go through, delete the tags and the useless sequences, remove the extra lines, and transcribe.  Here is the sequence followed by the command.
 
**(a)
 
**(a)
 +
cgguucaaauuacgguagugauaccccagaggauuagauggccaaagaagacaauauugaaaugcaagguaccguucuug
 +
aaacguugccuaauaccauguuccgcguagaguuagaaaacggucacgugguuacugcacacaucuccgguaaaaugcgca
 +
aaaacuacauccgcauccugacgggcgacaaagugacuguugaacugaccccguacgaccugagcaaaggccgcauugu
 +
cuuccguagucgcugauuguuuuaccgccugaugggcgaagagaaagaacgaguaaaaggucgguuuaaccggccuuuuuauu
 +
 
**(b)
 
**(b)
Exception encountered, of type "Error"
[ad85183e] /biodb/fall2015/index.php?diff=prev&oldid=1856&title=Jwoodlee_Week_4 Error from line 434 of /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php: Call to undefined function each()
Backtrace:
#0 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(544): DiffEngine->diag()
#1 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(344): DiffEngine->compareSeq()
#2 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(227): DiffEngine->diffLocal()
#3 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(721): DiffEngine->diff()
#4 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(859): Diff->__construct()
#5 /apps/xmlpipedb/biodb/fall2015/includes/diff/DairikiDiff.php(980): MappedDiff->__construct()
#6 /apps/xmlpipedb/biodb/fall2015/includes/diff/TableDiffFormatter.php(194): WordLevelDiff->__construct()
#7 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(140): TableDiffFormatter->changed()
#8 /apps/xmlpipedb/biodb/fall2015/includes/diff/DiffFormatter.php(82): DiffFormatter->block()
#9 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(888): DiffFormatter->format()
#10 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(802): DifferenceEngine->generateTextDiffBody()
#11 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(733): DifferenceEngine->generateContentDiffBody()
#12 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(662): DifferenceEngine->getDiffBody()
#13 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(632): DifferenceEngine->getDiff()
#14 /apps/xmlpipedb/biodb/fall2015/includes/diff/DifferenceEngine.php(453): DifferenceEngine->showDiff()
#15 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(795): DifferenceEngine->showDiffPage()
#16 /apps/xmlpipedb/biodb/fall2015/includes/page/Article.php(506): Article->showDiffPage()
#17 /apps/xmlpipedb/biodb/fall2015/includes/actions/ViewAction.php(44): Article->view()
#18 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(395): ViewAction->show()
#19 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(273): MediaWiki->performAction()
#20 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(566): MediaWiki->performRequest()
#21 /apps/xmlpipedb/biodb/fall2015/includes/MediaWiki.php(414): MediaWiki->main()
#22 /apps/xmlpipedb/biodb/fall2015/index.php(44): MediaWiki->run()
#23 {main}