Kevin Wyllie Week 2
From LMU BioDB 2015
Revision as of 04:12, 14 September 2015 by Kwyllie (Talk | contribs) (Again, just saving my progress so that I don't lose any work.)
Week 2 Journal
The given DNA sequence is written in the top strand, while its complementary strand is shown below it.
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' 3'-gc ata cga tta tgg tac aag gcg cat att ggg tcg gcg gtc aag gcg acc gcc gta aaa t- 5'
Translated reading frames:
- +1 R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (This is an open reading frame)
- +2 V-C
- +3 Y-A-N-T-M-F-R-V
- -1 The first codon in this reading frame is a STOP codon.
- -2 K-M-P-P-A-E-L-A-A-G
- -3
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'
