Kevin Wyllie Week 2

Kwyllie Week 2

The given DNA sequence is written in the top strand, while its complementary strand is shown below it.

5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3'
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'

Translated reading frames:

• +1 R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (This is an open reading frame.)
• +2 V-C
• +3 Y-A-N-T-M-F-R-V
• -1 The first codon in this reading frame is a STOP codon.
• -2 K-M-P-P-A-E-L-A-A-G
• -3 K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (This is an open reading frame.)User:Kwyllie