Kevin Wyllie Week 2

From LMU BioDB 2015
Revision as of 04:41, 14 September 2015 by Kwyllie (Talk | contribs) (I fixed some syntax errors.)

Jump to: navigation, search

Journal Week 2

The given DNA sequence is written in the top strand, while its complementary strand is shown below it.


5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3'
3'- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'


Translated reading frames:

  • +1 R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (This is an open reading frame.)
  • +2 V-C
  • +3 Y-A-N-T-M-F-R-V
  • -1 The first codon in this reading frame is a STOP codon.
  • -2 K-M-P-P-A-E-L-A-A-G
  • -3 K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (This is an open reading frame.)