Kevin Wyllie Week 2
From LMU BioDB 2015
Revision as of 03:31, 15 September 2015 by Kwyllie (Talk | contribs) (I went ahead and added the "Nter" and "Cter" notation just for explicit clarity.)
Journal Week 2
The given DNA sequence is written in the top strand, while its complementary strand is shown below it.
5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaa t- 5'
Translated reading frames:
- +1 Nter-R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-Cter (This is an open reading frame.)
- +2 Nter-V-C-Cter
- +3 Nter-Y-A-N-T-M-F-R-V-Cter
- -1 The first codon in this reading frame is a STOP codon, so there is no polypeptide.
- -2 Nter-K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I-Cter (This is an open reading frame.)
- -3 Nter-K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y-Cter (This is an open reading frame.)
