Rlegaspi Week 4

From LMU BioDB 2015
Revision as of 22:04, 28 September 2015 by Rlegaspi (Talk | contribs) (Edit headings throughout page. New format. Will do this to other pages.)

Jump to: navigation, search

Transcription and Translation “Taken to the Next Level”

This computer exercise examines gene expression at a much more detailed level than before, requiring knowledge in both the biological aspects of the process and the translation of these steps into computer text-processing equivalents.

To begin the assignment, I needed to log into my account through the Terminal application on my MacBook: 

ssh rlegaspi@my.cs.lmu.edu

And I typed in my password; then, I accessed the Dondi's folder which contained the infA-E.coli-K12.txt file: 

cd ~dondi/xmlpipedb/data

To view the specific sequence that we are practicing for this week's assignment I inputed the following command: 

cat infA-E.coli-K12.txt
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgc
tcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgtt
gcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc
tttacttatttacagaacttcggcattatcttgccggttcaaattacggtagtgataccccagaggattagatggcc
aaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaa
cggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtga
ctgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatg
ggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat

Modifying the gene sequence string: Highlighting ("Tagging") the special sequences within the gene

Completing this assignment required a review of Introduction to the Command Line page and a reading of the More Text Processing Features page. In class, my Homework Partner Anu Varshneya and I were able to get clues and hints on how to complete our assignment from Professor User:Dondi. Firstly, we were able to learn the placement of possible -35 box and -10 box locations in the sequence and how to "tag" these special sequences. We were able to search for both of the special sequences concurrently with the knowledge that the sequence for a -35 box is tt[gt]ac[at] and the sequence for a -10 box is [ct]at[at]at. We could have used grep to search for the sequences individually, but to see where the potential locations for both -35 box and -10 box we used the following command: 

cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ *&* /g" | sed "s/[ct]at[at]at/ **&** /g"
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgt **tataat** tgcggtcgcagagttggttacgct
cattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgtt
gcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc
*tttact* ta *tttaca* gaacttcgg **cattat** cttgccggttcaaattacggtagtgataccccagaggattagatggcc
aaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaa
cggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtga
ctgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatg
ggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat

Exact mRNA sequence transcribed from this gene

Amino Acid sequence translated from this mRNA

Electronic Lab Notebook

  • Discussion in class with Anu - Finding the minus35box and Finding the minus10box and inserting the descriptions around the codes (in-class work time) - To be written

Links to User Page and Journal Pages

Ron Legaspi
BIOL 367, Fall 2015

Assignment Links
Individual Weekly Journals
Shared Weekly Journals

Homework Partner: Anu Varshneya

Retrieved from "https://xmlpipedb.lmucs.io/biodb/fall2015/index.php?title=Rlegaspi_Week_4&oldid=1846"