Kevin Wyllie Week 2
From LMU BioDB 2015
								Revision as of 04:40, 14 September 2015 by Kwyllie (Talk | contribs) (Another attempt to fix the link to my user page.)
Kwyllie Week 2
The given DNA sequence is written in the top strand, while its complementary strand is shown below it.
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta- 3' 3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat- 5'
Translated reading frames:
- +1 R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (This is an open reading frame.)
 - +2 V-C
 - +3 Y-A-N-T-M-F-R-V
 - -1 The first codon in this reading frame is a STOP codon.
 - -2 K-M-P-P-A-E-L-A-A-G
 - -3 K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (This is an open reading frame.)User:Kwyllie