Rlegaspi Week 3

From LMU BioDB 2015
Revision as of 03:07, 21 September 2015 by Rlegaspi (Talk | contribs) (Added a sentence to electronic lab notebook.)

Jump to: navigation, search

Individual Journal Assignment

Homework Partner

Kevin Wyllie

The Genetic Code, by Computer

Connect to the my.cs.lmu.edu workstation as shown in class and do the following exercises from there.

For these exercises, two files are available in the Keck lab system for practice; of course, you can always make your own sequences up. The practice files are ~dondi/xmlpipedb/data/prokaryote.txt and ~dondi/xmlpipedb/data/infA-E.coli-K12.txt.

Complement of a Strand

Write a sequence of piped text processing commands that, when given a nucleotide sequence, returns its complementary strand. In other words, fill in the question marks: 

   cat sequence_file | ?????

Sequence file: ~dondi/xmlpipedb/data/prokaryote.txt 

tctactatatttcaataggtacgatggccaaagaagacaatattgaacttgaaacgttgcctaataccatgttccgcgtataacccagccgccagttccgctggcggcattttaac

Sequence of Piped Text Processing Commands: 

cat prokaryote.txt | sed "y/atcg/tagc/"

Result of Text Processing Commands: The Complimentary Strand of the Nucleotide Sequence (3'-5' direction) from ~dondi/xmlpipedb/data/prokaryote.txt 

agatgatataaagttatccatgctaccggtttcttctgttataacttgaactttgcaacggattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaattg


Reading Frames

Write 6 sets of text processing commands that, when given a nucleotide sequence, returns the resulting amino acid sequence, one for each possible reading frame for the nucleotide sequence. In other words, fill in the question marks: 

   cat sequence_file | ?????

Sequence file: ~dondi/xmlpipedb/data/prokaryote.txt 

tctactatatttcaataggtacgatggccaaagaagacaatattgaacttgaaacgttgcctaataccatgttccgcgtataacccagccgccagttccgctggcggcattttaac
  • +1 Reading Frame Amino Acid Sequence
S T I F Q - V R W P K K T I L N L K R C L I P C S A Y N P A A S S A G G I L 
Command Sequence: cat prokaryote.txt | sed "s/..$//g" | sed "y/t/u/" | sed "s/.../& /g" | sed -f genetic-code.sed
  • +2 Reading Frame Amino Acid Sequence
L L Y F N R Y D G Q R R Q Y - T - N V A - Y H V P R I T Q P P V P L A A F - 
Command Sequence: cat prokaryote.txt | sed "s/^.//g" | sed "s/.$//g" | sed "y/t/u/" | sed "s/.../& /g" | sed -f genetic-code.sed
  • +3 Reading Frame Amino Acid Sequence
Y Y I S I G T M A K E D N I E L E T L P N T M F R V - P S R Q F R W R H F N 
Command Sequence: cat prokaryote.txt | sed "s/^..//g" | sed "y/t/u/" | sed "s/.../& /g" | sed -f genetic-code.sed
  • -1 Reading Frame Amino Acid Sequence
V K M P P A E L A A G L Y A E H G I R Q R F K F N I V F F G H R T Y - N I V 
Command Sequence: cat prokaryote.txt | sed "y/tagc/aucg/" | rev | sed "s/.../& /g" | sed "s/..$//g" | sed -f genetic-code.sed
  • -2 Reading Frame Amino Acid Sequence 
L K C R Q R N W R L G Y T R N M V L G N V S S S I L S S L A I V P I E I - - 
Command Sequence: cat prokaryote.txt | sed "y/tagc/aucg/" | rev | sed "s/^.//g" | sed "s/.$//g" |  sed "s/.../& /g" | sed -f genetic-code.sed
  • -3 Reading Frame Amino Acid Sequence 
- N A A S G T G G W V I R G T W Y - A T F Q V Q Y C L L W P S Y L L K Y S R
Command Sequence: cat prokaryote.txt | sed "y/tagc/aucg/" | rev | sed "s/^..//g" | sed "s/.../& /g" | sed -f genetic-code.sed

Checking My Work: ExPASy Translate Tool

ExPASy Translate Tool Results for prokaryote.txt DNA Sequence - Thank you, Brandon Klein, for uploading the image.

  • Note: The amino acid sequences that I recovered from using text processing commands (and the Terminal app on my MacBook) are a match to the ExPASy Translate Tool results of the same DNA sequence from the prokaryote.txt file.

XMLPipeDB Match Practice

For your convenience, the XMLPipeDB Match Utility (xmlpipedb-match-1.1.1.jar) has been installed in the ~dondi/xmlpipedb/data directory alongside the other practice files. Use this utility to answer the following questions:

  1. What Match command tallies the occurrences of the pattern GO:000[567] in the 493.P_falciparum.xml file?
    • How many unique matches are there?
    • How many times does each unique match appear?
  2. Try to find one such occurrence “in situ” within that file. Look at the neighboring content around that occurrence.
    • Describe how you did this.
    • Based on where you find this occurrence, what kind of information does this pattern represent?
  3. What Match command tallies the occurrences of the pattern \"Yu.*\" in the 493.P_falciparum.xml file?
    • How many unique matches are there?
    • How many times does each unique match appear?
    • What information do you think this pattern represents?
  4. Use Match to count the occurrences of the pattern ATG in the hs_ref_GRCh37_chr19.fa file (this may take a while). Then, use grep and wc to do the same thing.
    • What answer does Match give you?
    • What answer does grep + wc give you?
    • Explain why the counts are different. (Hint: Make sure you understand what exactly is being counted by each approach.)

Electronic Lab Notebook

  1. To complete the first part of The Genetic Code, by Computer (Complement of a Strand), I firstly had to connect to the my.cs.lmu.edu work station on my MacBook Pro laptop. Thankfully, my homework partner Kevin
    told me in class that we need to be connected to the LMU network [i.e. Student(Secure)], which saved a lot of frustration because I was planning to work from home. I do understand that it is required to connect via LMU network because the computer that operates the my.cs.lmu.edu is on campus. Focusing more on the assignment, I found it useful to write my thoughts out on paper before using my Terminal app and my.cs.lmu.edu work station. I chose the shortest of the two practice files. When thinking about complimentary strand of the DNA sequence, I figured that all of the nucleotides needed to be changed into their compliments (a to t, t to a, c to g, g to c). From the Tuesday Dondi lecture, I remember the command used to replace characters into desired characters - sed "y/ / /". The piped text processing commands of cat prokaryote.txt | sed "y/atcg/tagc/" produced the expected output that I wanted, which was the compliment strand.
  2. To complete the second part of the The Genetic Code, by Computer (Reading Frames), I did the same logging in steps as the first part of the assignment. The task of producing the amino acid sequences of all 6 reading frames was a challenging one because it required most of the skills learned from class and being able to apply what was learned to produce the results desired. I knew at first that I needed to get the file (cat prokaryote). Then I had to figure out a way in which to separate the nucleotides into three-nucleotide codons (sed "s/.../& /g") [Thank you Dr. Dionisio for helping me remember this important step, because otherwise the result of the piped text processing commands would have been a mix of nucleotides and amino acids]. Then I needed to change the t's to u's (sed "y/t/u/"). I also had to cut the last two nucleotides from the DNA sequence because they wouldn't be translated (sed "s/..$//g") - I would have to use variations of this command to cut out the nucleotides at the end or beginning that would not be translated. Finally, I inputed the command that would use the genetic-code.sed file to translate the codons into the amino acid sequence (sed -f genetic-code.sed). Up until this point, the sequence of commands were used for the +1, +2, and +3 reading frames, but for the -1, -2, and -3 reading frames there were more steps involved. I needed a command that would give me the 3'-5' complimentary strand (sed "y/tagc/aucg/"). I needed to get the complimentary strand into the 5'-3' direction (rev). Then I used the same commands in order to cut out the nucleotides that would not be translated and used the genetic-code.sed file to translate. I am not going to lie: This part of the assignment required plenty of trial and error, and I would not have reached the results I wanted without the help of Dr. Dionisio Introduction to the Command Line and his advice via email; in addition, it required a lot of critical thinking and playing around with the different commands we, as a class, were taught in lectures. I checked my work using the ExPASy Translate Tool online and was glad to know that my answers corresponded with the translation tool.

Links to User Page and Journal Pages

Ron Legaspi
BIOL 367, Fall 2015

Assignment Links
Individual Weekly Journals
Shared Weekly Journals
Retrieved from "https://xmlpipedb.lmucs.io/biodb/fall2015/index.php?title=Rlegaspi_Week_3&oldid=1415"