Jwoodlee Week 4
Transcription and Translation “Taken to the Next Level”
This computer exercise examines gene expression at a much more detailed level than before, requiring knowledge in both the biological aspects of the process and the translation of these steps into computer text-processing equivalents.
The following sequence represents a real gene, called infA and found in E. coli K12. As you might have guessed, it’s stored as infA-E.coli-K12.txt in ~dondi/xmlpipedb/data.
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgc tcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgtt gcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc tttacttatttacagaacttcggcattatcttgccggttcaaattacggtagtgataccccagaggattagatggcc aaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaa cggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtga ctgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatg ggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat
For each of the following questions pertaining to this gene, provide (a) the actual answer, and (b) the sequence of text-processing commands that calculates this answer. Specific information about how these sequences can be identified is included after the list of questions.
I opened up terminal, and used the ssh command to get into dondi's directory: ~dondi/xmlpipedb/data. In there I got access to infA-E.coli-K12.txt which is the nucleotide sequence I will be using for this assignment.
- Modify the gene sequence string so that it highlights or “tags” the special sequences within this gene, as follows (ellipses indicate bases in the sequence; note the spaces before the start tag and after the end tag):
- -35 box of the promoter
- As shown in class I used the sed command to get the first occurrence of the minus 35 strand in the sequence:
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box> \n/1"
- -10 box of the promoter
- In order to get the 10 box filled correctly I made a new line after the 35 box, counted 17 bits into the new line, and then made another new line. I then took the first occurrence of the 3rd line that matched the -10 box sequence. This obviously works to find the correct sequence, however it breaks up the entire sequence into 3 lines, so at the end I will have to remedy this.
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>/1"
- transcription start site
- Knowing that the TSS was 12 characters away from the first character of the -10 box, I counted 5 characters after the last -10 character, made a new line and then knew that the first character on that new line would be the TSS, how I did that can be seen in the commands below.
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>/g"
- ribosome binding site
- To find the ribosome binding site, I made a new line after the TSS and found the next occurrence of "gagg" as per the assignment specifications:
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>/1"
- start codon
- I found the start codon in much the same way as I found the rest of the sequences. I made a new line after the previous sequence, and then found the first occurrence of "atg", and then marked it up.
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>/1"
- stop codon
... <stop_codon>...</stop_codon> ...
- The stop codon requires I find one of three possible three character sequences. At first I tried using brackets: "t[ag][ag]", but I soon found out that that yielded too many results. There are only three stop codons and the brackets give me 4 unique codons. So into the wiki I went, and realized I could use a vertical bar to separate three unique codons, and search for them. The problem however, was that this did not work. After being stumped for awhile I realized that before I piped to that command I needed to break up the line into sets of 3, just like I did in the week 3 assignment. As a result I got this command:
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>\n/1" | sed "8s/.../& /g"| sed -r "8s/tag|tga|taa/<stop_codon>&<\/stop_codon>/1"
- The stop codon requires I find one of three possible three character sequences. At first I tried using brackets: "t[ag][ag]", but I soon found out that that yielded too many results. There are only three stop codons and the brackets give me 4 unique codons. So into the wiki I went, and realized I could use a vertical bar to separate three unique codons, and search for them. The problem however, was that this did not work. After being stumped for awhile I realized that before I piped to that command I needed to break up the line into sets of 3, just like I did in the week 3 assignment. As a result I got this command:
- terminator
- The first part of the terminator hairpin is:
aaaaggt, which means, abiding by the rules of the terminator provided to us, that the first half bonds withgcctttt. So now the trick is to grab the correct terminator sequence. I ended up breaking the terminator command into two different commands. I used one to insert the first tag, and the second one to insert the second tag. I did this because I wasn't sure how long the sequence would be between the two hairpin sequences. This is what I got to capture the terminator sequence:cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>\n/1" | sed "8s/.../& /g"| sed -r "8s/tag|tga|taa/<stop_codon>&<\/stop_codon>/1" | sed "8s/ //g" | sed "8s/aaaaggt/<terminator>&/g" | sed -r "8s/gcctttt..../&<\/terminator>/g"
- The first part of the terminator hairpin is:
- And so, finally, it is all marked up. However I'm not quite done yet, I need to get rid of all the new lines I created. In order to do this I used this command: sed ':a;N;$!ba;s/\n//g' (from wiki), so the final output is as follows.
- (a)
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacgctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacgttgcgcttttggtgcggcttagccgtgtgttttcg gagtaatgtgccgaacctgtttgttgcgatttagcgcgcaaatc<minus35box>tttact</minus35box>tatttacagaacttcgg<minus10box>cattat</minus10box>cttgc<tss>c</tss>ggttcaaattacggtagtgatacccca <rbs>gagg</rbs>attag<start_codon>atg</start_codon>gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttac tgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgc<stop_codon>tga</stop_codon> ttgttttaccgcctgatgggcgaagagaaagaacgagt<terminator>aaaaggtcggtttaaccggcctttttatt</terminator>ttat
- (b)And the final command is as follows:
cat infA-E.coli-K12.txt | sed "s/tt[gt]ac[at]/ <minus35box>&<\/minus35box>\n/1" | sed -r "2s/^.{17}/&\n/g" | sed -r "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/1" | sed -r "4s/^.{5}/&\n/g" | sed "5s/^./<tss>&<\/tss>\n/g" | sed "6s/gagg/<rbs>&<\/rbs>\n/1" | sed "7s/atg/<start_codon>&<\/start_codon>\n/1" | sed "8s/.../& /g"| sed -r "8s/tag|tga|taa/<stop_codon>&<\/stop_codon>/1" | sed "8s/ //g" | sed "8s/aaaaggt/<terminator>&/g" | sed -r "8s/gcctttt..../&<\/terminator>/g" | sed ':a;N;$!ba;s/\n//g'
- What is the exact mRNA sequence that is transcribed from this gene?
- In order to get the mRNA sequence I need to get the sequence between the transcription start site and the terminator. The most natural way to do this is to use the line breaks I created when I tagged up the sequence, and delete the lines that are unnecessary. Using sed, I can delete lines. Example:
sed "2,4D"So, using this trick, I will delete lines 1-4 and then the last line after the terminator. From there all nucleotides not deleted should be transcribed into mRNA. - (a)
- (b)
- What is the amino acid sequence that is translated from this mRNA?
- (a)
- (b)
Supplementary Information
As a sample answer for the first question, Week 2’s paper handout sequence would have been marked as follows (line breaks are included only for clarity):
agtgta <minus35box>ttgaca</minus35box> tgatagaagcactctac <minus10box>tatatt</minus10box> tcaat <tss>a</tss> ttcctag <rbs>gagg</rbs> tttgacct <start_codon>atg</start_codon> attgaacttgaa...aataccatggta <stop_codon>taa</stop_codon> ccca <terminator>gccgccagttccgctggcggcatttt</terminator> aac
Note: The commands needed to generate the output above will be similar, but not exactly the same as the ones needed for infA.
Base your commands on the following hints/guidelines about the gene, plus your own knowledge learned from the past few weeks:
- The consensus sequence for the -10 site is
[ct]at[at]at. - The consensus sequence for the -35 site is
tt[gt]ac[at]. - The ideal number of base pairs between the -35 and -10 box is 17, counting from the first nucleotide after the end of the -35 sequence up to the last nucleotide before the -10 sequence.
- The transcription start site is located at the 12th nucleotide after the first nucleotide of the -10 box.
- A consensus sequence for the ribosome binding site is
gagg. - The first half of the terminator “hairpin” is
aaaaggt, where theuin the mRNA binds with aginstead of the usuala. - The terminator includes 4 more nucleotides after the hairpin completes.
Computer Tips
- Remember that
sedis line-based, and that you can add and count lines to get certain things done, say strictly before or after a certain point. - Don’t forget how you enforced reading frames in Week 3.
- If you do add lines or spaces to get the job done, make sure to clean up after yourself by removing them from the final answer.
- This exercise is difficult enough that you might be thinking to yourself, “I’d rather do this by hand!” This sentiment is understandable, but when you find yourself feeling this way, consider the following:
- Part of the difficulty is learning these things for the first time. Once you’ve gotten the hang of it, there’s no way that doing things by hand will be faster.
- Consider trying to do this over and over, for multiple genes, with lots of potential variations. Doing this by hand not only takes longer at this point, but risks errors that a computer won’t make (once the correct commands have been determined).
- Form your commands so that they can be strung together into a single pipeline of processing directives in the end. In other words, once you’ve figured out how to do each step, no human intervention should be needed to perform everything from beginning to end.
- You will need the More Text Processing Features wiki page to complete this assignment. The How to Read XML Files wiki page gives you an idea for why the requested output was formatted the way it was.