Aporras1 Electronic Notebook - Revision history

Aporras1: /* Study the curl'ed Code */ added numbering and grep/sed

2017-09-20T06:56:50Z

‎Study the curl'ed Code: added numbering and grep/sed

Aporras1: /* Study the curl'ed Code */ fixed spacing

2017-09-20T06:37:55Z

‎Study the curl'ed Code: fixed spacing

Aporras1: /* Study the curl'ed Code */ added the identifiers from using dev tools

2017-09-20T06:36:24Z

‎Study the curl'ed Code: added the identifiers from using dev tools

Aporras1: /* Study the curl'ed Code */ final edits to curl links

2017-09-20T06:26:15Z

‎Study the curl'ed Code: final edits to curl links

Aporras1: /* Study the curl'ed Code */ more links and descriptions

2017-09-20T06:22:19Z

‎Study the curl'ed Code: more links and descriptions

Aporras1: /* Study the curl'ed Code */ fixing links display

2017-09-20T06:17:07Z

‎Study the curl'ed Code: fixing links display

Aporras1: first 3 links with descriptions

2017-09-20T06:15:17Z

first 3 links with descriptions

Aporras1: /* DMing the Server with curl */ further notes on final curl

2017-09-20T02:17:30Z

‎DMing the Server with curl: further notes on final curl

Aporras1: /* DMing the Server with curl */ second attempt

2017-09-20T01:54:40Z

‎DMing the Server with curl: second attempt

Aporras1: /* DMing the Server with curl */

2017-09-20T01:51:06Z

‎DMing the Server with curl

@@ Line 84: / Line 84: @@
 Identifiers:
-sib_top: The top of the webpage.
+#sib_top: The top of the webpage.
-sib_container: The "container" of the webpage.
+#Couldn't figure out how to use the grep and sed commands in command line.

@@ Line 85: / Line 85: @@
 Identifiers:
 sib_top: The top of the webpage.
 sib_container: The "container" of the webpage.
 sib_header_small: The small header for the webpage.
 sib_body: The "body" of the webpage outside of the container.
 sib_footer: The footer at the bottom of the webpage.
 sib_expasy_logo: Logo at the top right of the page.
 resource_header: Header of the webpage.
 sib_header_nav: Homepage link at the top right of the page for navigation.

← Older revision		Revision as of 06:36, 20 September 2017
Line 82:		Line 82:
	#https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.		#https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.
	#https://www.expasy.org/disclaimer.html : Expasy disclaimer.		#https://www.expasy.org/disclaimer.html : Expasy disclaimer.
		+
		+	Identifiers:
		+	sib_top: The top of the webpage.
		+	sib_container: The "container" of the webpage.
		+	sib_header_small: The small header for the webpage.
		+	sib_body: The "body" of the webpage outside of the container.
		+	sib_footer: The footer at the bottom of the webpage.
		+	sib_expasy_logo: Logo at the top right of the page.
		+	resource_header: Header of the webpage.
		+	sib_header_nav: Homepage link at the top right of the page for navigation.

← Older revision		Revision as of 06:26, 20 September 2017
Line 81:		Line 81:
	#http://web.expasy.org/translate/ : Expasy translation tool.		#http://web.expasy.org/translate/ : Expasy translation tool.
	#https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.		#https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.
		+	#https://www.expasy.org/disclaimer.html : Expasy disclaimer.

@@ Line 76: / Line 76: @@
 #http://www.w3.org/TR/html4/loose.dtd : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures."
-#http://web.expasy.org/favicon.ico : The logo for expasy.
+#http://web.expasy.org/favicon.ico : The logo for Expasy.
-#http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics
+#http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics.

@@ Line 75: / Line 75: @@
 Below, going line by line clicking each link and describing where it leads
-#[[http://www.w3.org/TR/html4/loose.dtd]] : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures."
+#http://www.w3.org/TR/html4/loose.dtd : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures."
-#[[http://web.expasy.org/favicon.ico]] : The logo for expasy.
+#http://web.expasy.org/favicon.ico : The logo for expasy.
-#[[http://www.sib.swiss]] : The main web page for Swiss Institute of Bioinformatics
+#http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics

← Older revision		Revision as of 06:15, 20 September 2017
Line 70:		Line 70:
	#Talked more with Simon and realized it should be "http://web.expasy.org/cgi-bin/translate/dna_aa" and not "https://expasy.org/cgi-bin/translate/dna_aa"		#Talked more with Simon and realized it should be "http://web.expasy.org/cgi-bin/translate/dna_aa" and not "https://expasy.org/cgi-bin/translate/dna_aa"
	#Attempt 4: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa		#Attempt 4: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
		+
		+	==Study the curl'ed Code==
		+
		+	Below, going line by line clicking each link and describing where it leads
		+
		+	#[[http://www.w3.org/TR/html4/loose.dtd]] : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures."
		+	#[[http://web.expasy.org/favicon.ico]] : The logo for expasy.
		+	#[[http://www.sib.swiss]] : The main web page for Swiss Institute of Bioinformatics

← Older revision		Revision as of 02:17, 20 September 2017
Line 66:		Line 66:
	#First attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" which did not work.		#First attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" which did not work.
	#Second attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" https://expasy.org/translate		#Second attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" https://expasy.org/translate
		+	#Consulted another source to realize I needed to also add &Submit=TRANSLATE SEQUENCE to the code along with the correct POST which would be "/cgi-bin/translate/dna_aa"
		+	#Third attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" https://expasy.org/cgi-bin/translate/dna_aa which also failed.
		+	#Talked more with Simon and realized it should be "http://web.expasy.org/cgi-bin/translate/dna_aa" and not "https://expasy.org/cgi-bin/translate/dna_aa"
		+	#Attempt 4: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

← Older revision		Revision as of 01:54, 20 September 2017
Line 65:		Line 65:
	#Looked at various curl codes and found curl -d sends data as a POST as if the user has filled out certain forms. The examples used: -d name=Antonio if I was putting my name into a form.		#Looked at various curl codes and found curl -d sends data as a POST as if the user has filled out certain forms. The examples used: -d name=Antonio if I was putting my name into a form.
	#First attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" which did not work.		#First attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" which did not work.
		+	#Second attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" https://expasy.org/translate

← Older revision		Revision as of 01:51, 20 September 2017
Line 64:		Line 64:
	#Inferring from the code mentioned prior, the text within the box is known as "pre_text".		#Inferring from the code mentioned prior, the text within the box is known as "pre_text".
	#Looked at various curl codes and found curl -d sends data as a POST as if the user has filled out certain forms. The examples used: -d name=Antonio if I was putting my name into a form.		#Looked at various curl codes and found curl -d sends data as a POST as if the user has filled out certain forms. The examples used: -d name=Antonio if I was putting my name into a form.
		+	#First attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" which did not work.