Aporras1 Week 3 - Revision history

Aporras1: /* Study the curl'ed Code */ added identifiers from notebook

2017-09-20T06:37:20Z

‎Study the curl'ed Code: added identifiers from notebook

2017-09-20T06:28:50Z

added study the curl'ed code from notebook

2017-09-20T06:20:16Z

‎References: added 4th reference

2017-09-20T06:19:23Z

‎References: added 4th reference

2017-09-20T02:22:25Z

added curl code

2017-09-20T02:19:46Z

‎References: added third reference

2017-09-20T01:27:54Z

‎References: added curl reference

2017-09-19T23:42:35Z

‎"Hacked" Page without Developer Tools Visible: attempt 3 at image fix

2017-09-19T23:39:23Z

attempt 2 at fixing image

2017-09-19T23:38:38Z

attempt 1 at fixing image 2

@@ Line 29: / Line 29: @@
 #https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.
 #https://www.expasy.org/disclaimer.html : Expasy disclaimer.
 ==Acknowledgements==

← Older revision		Revision as of 06:28, 20 September 2017
Line 19:		Line 19:

	curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa		curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
		+
		+	==Study the curl'ed Code==
		+	'''Question 1:'''
		+	#http://www.w3.org/TR/html4/loose.dtd : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures."
		+	#http://web.expasy.org/favicon.ico : The logo for Expasy.
		+	#http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics.
		+	#https://www.expasy.org : The Expasy Bioinformatics Resource Portal.
		+	#http://web.expasy.org/translate/ : Expasy translation tool.
		+	#https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.
		+	#https://www.expasy.org/disclaimer.html : Expasy disclaimer.

	==Acknowledgements==		==Acknowledgements==

← Older revision		Revision as of 06:20, 20 September 2017
Line 32:		Line 32:
	#Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].		#Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].
	#xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].		#xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].
		+	#LMU BioDB 2017. (2017). Week 3. Retrieved September 16, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3

← Older revision		Revision as of 06:19, 20 September 2017
Line 31:		Line 31:
	#Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm		#Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm
	#Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].		#Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].
		+	#xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].

← Older revision		Revision as of 02:22, 20 September 2017
Line 13:		Line 13:

	[[File:Aporras1's Hacked Page without Developer Tools.png\|900px\|File:900pixels]]		[[File:Aporras1's Hacked Page without Developer Tools.png\|900px\|File:900pixels]]
		+
		+	==DMing the Server with curl==
		+
		+	'''Final curl code:'''
		+
		+	curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

	==Acknowledgements==		==Acknowledgements==

← Older revision		Revision as of 02:19, 20 September 2017
Line 24:		Line 24:
	#Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size		#Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size
	#Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm		#Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm
		+	#Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].

← Older revision		Revision as of 01:27, 20 September 2017
Line 23:		Line 23:
	==References==		==References==
	#Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size		#Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size
		+	#Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm

@@ Line 12: / Line 12: @@
 =="Hacked" Page without Developer Tools Visible==
-[[File:Aporras1's Hacked Page without Developer Tools.png|900px]]
+[[File:Aporras1's Hacked Page without Developer Tools.png|900px|File:900pixels]]
 ==Acknowledgements==