Bhamilton18 Week 2 - Revision history

Bhamilton18: Fixed the references spacing

2017-09-26T04:24:59Z

Fixed the references spacing

2017-09-14T17:49:44Z

Changed user template from journal entry template

2017-09-12T03:53:16Z

fixed antonio's name

2017-09-12T03:51:35Z

Added codon table reference

2017-09-12T03:47:50Z

Stop codon clarification

2017-09-09T23:13:02Z

Copying from Electronic Notebook

2017-09-09T22:27:58Z

Added Notebook

2017-09-09T22:20:52Z

RNA Strand

2017-09-09T22:19:45Z

Complementary Strand

2017-09-09T17:08:39Z

@@ Line 61: / Line 61: @@
 LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
 Genetic code. (2017, August 31). Retrieved September 09, 2017, from https://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table
 [[Category: Journal Entry]]

@@ Line 49: / Line 49: @@
 The following readings frames are: '''open reading frames:''' +1, -2, -3 <!--These strands do not contain a "stop" codon-->
-{{Template:Bhamilton18 Journal Entries}}
+{{Template:Bhamilton18}}
 == Acknowledgements ==

@@ Line 53: / Line 53: @@
 == Acknowledgements ==
-I collaborated with [[User:Aporras1| Antionio Porras]] on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA, reading frames, and open reading frames together.
+I collaborated with [[User:Aporras1| Antonio Porras]] on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA, reading frames, and open reading frames together.
 '''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.'''

@@ Line 53: / Line 53: @@
 == Acknowledgements ==
-I collaborated with [[User:Aporras1| Antionio Porras]] on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA and reading frames together.
+I collaborated with [[User:Aporras1| Antionio Porras]] on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA, reading frames, and open reading frames together.
 '''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.'''
@@ Line 61: / Line 61: @@
 LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
 [[Category: Journal Entry]]

@@ Line 25: / Line 25: @@
 '''Reading Frame + 2'''
-'-V-S-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F-3'
+'-V-S-Stop|-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F-3'
 '''Reading Frame +3:'''
-'-Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F-3'
+'-Y-A-N-T-M-F-R-V-Stop|-P-S-R-Q-F-R-W-R-H-F-3'
 '''Reading Frame -1'''
-'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop-N-5'
+'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop|-N-5'
 '''Reading Frame -2'''
@@ Line 42: / Line 42: @@
 '-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-5'
 <br>

@@ Line 21: / Line 21: @@
 '''Reading Frame +1'''
-'- R-
+'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-3'
 {{Template:Bhamilton18 Journal Entries}}

@@ Line 1: / Line 1: @@
 ==Genetic Code==
@@ Line 12: / Line 13: @@
 '''RNA Strand:'''
-'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5'
+'-cgu aug cuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua-3’ (Strand 1)
 {{Template:Bhamilton18 Journal Entries}}
@@ Line 18: / Line 27: @@
 == Acknowledgements ==
-I collaborated with [[User:Aporras1| Antionio Porras]] on this assignment. We communicated through texting/messaging. We worked on ... together.
+I collaborated with [[User:Aporras1| Antionio Porras]] on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA and reading frames together.
 '''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.'''

← Older revision		Revision as of 22:20, 9 September 2017
Line 10:		Line 10:
	3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5'		3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5'

		+	'''RNA Strand:'''

		+	3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5'

	{{Template:Bhamilton18 Journal Entries}}		{{Template:Bhamilton18 Journal Entries}}

← Older revision		Revision as of 22:19, 9 September 2017
Line 1:		Line 1:
		+
		+	==Genetic Code==
		+
		+	'''Original Strand:'''
		+
		+	5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
		+
		+	'''Complementary Strand:'''
		+
		+	3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5'
		+
		+
		+
	{{Template:Bhamilton18 Journal Entries}}		{{Template:Bhamilton18 Journal Entries}}

← Older revision		Revision as of 17:08, 9 September 2017
Line 11:		Line 11:

	LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2		LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
		+
		+	[[Category: Journal Entry]]