Dbashour Week 3 - Revision history

Dbashour: syntax fix

2017-09-19T22:51:27Z

syntax fix

2017-09-19T22:50:30Z

syntax fix

2017-09-19T22:49:39Z

added acknowledgements and references

2017-09-19T22:44:46Z

added signature

2017-09-19T22:25:32Z

category added

2017-09-19T19:26:34Z

screenshots of changed text added

2017-09-19T19:24:06Z

picture link with details added

2017-09-19T19:20:59Z

added picture

2017-09-19T19:15:29Z

category made

2017-09-19T19:14:16Z

syntax fix

@@ Line 78: / Line 78: @@
 ==Acknowledgements==
-I worked with my homework partner [[user:QLanners | Quinn Lanners]] on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
+I worked with my homework partner [[user:qlanners | Quinn Lanners]] on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
 ==References==

@@ Line 78: / Line 78: @@
 ==Acknowledgements==
-I worked with my homework partner [[user:QLanners]] on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
+I worked with my homework partner [[user:QLanners | Quinn Lanners]] on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
 ==References==

@@ Line 77: / Line 77: @@
 #* The button going to the top of the page included in the footer
 [[User:Dbashour|Dbashour]] ([[User talk:Dbashour|talk]]) 15:44, 19 September 2017 (PDT)
 {{Template:Dbashour}}
 [[Category:Journal Entry]]

@@ Line 77: / Line 77: @@
 #* The button going to the top of the page included in the footer
 {{Template:Dbashour}}
 [[Category:Journal Entry]]

← Older revision		Revision as of 19:26, 19 September 2017
Line 1:		Line 1:
	==Screenshots of changed text==		==Screenshots of changed text==
		+	[[File: welcome to dina's empire with details.png]]
		+	[[File: welcome to dina's empire.png]]

	==Screenshots of changed picture==		==Screenshots of changed picture==

@@ Line 2: / Line 2: @@
 ==Screenshots of changed picture==
 [[File: changed picture.png]]
 ==Curl Command used to retrieve info:==

@@ Line 1: / Line 1: @@
-Curl Command used to retrieve info:
+==Screenshots of changed text==
   curl -X POST -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa
-Command used to get "just the answers"
+==Command used to get "just the answers"==
   curl -X POST -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa | sed "1,47d" | sed "13q" | sed "s/<[^>]*>//g"
-Links to other pages:
+==Links to other pages:==
 #http://www.w3.org/TR/html4/loose.dtd
 #*A HTML document "which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures"
@@ Line 45: / Line 51: @@
 #* Java script code used within the website
-Identifiers:
+==Identifiers:==
 #sib_top
 #*The very top of the page
@@ Line 70: / Line 76: @@
 {{Template:Dbashour}}

← Older revision		Revision as of 19:15, 19 September 2017
Line 69:		Line 69:
	#* The button going to the top of the page included in the footer		#* The button going to the top of the page included in the footer

−	~~[https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/~~Template:Dbashour]	+	{{Template:Dbashour}}
		+	[category:Journal Entry]

← Older revision		Revision as of 19:14, 19 September 2017
Line 69:		Line 69:
	#* The button going to the top of the page included in the footer		#* The button going to the top of the page included in the footer

−	[~~template~~:~~dbashour~~]	+	[https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Template:Dbashour]