Dbashour week 2 - Revision history

Dbashour at 06:11, 12 September 2017

2017-09-12T06:11:01Z

Dbashour: acknowledgements, references, links

2017-09-12T04:57:49Z

acknowledgements, references, links

Dbashour: added translations and reading frames

2017-09-12T04:44:26Z

added translations and reading frames

Dbashour: DNA and Contemporary DNA strand created

2017-09-12T04:11:43Z

DNA and Contemporary DNA strand created

New page

DNA strand
5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
Contemporary DNA Strand
3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'

@@ Line 12: / Line 12: @@
 '- Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F -3'
 ===-1===
-'  Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3'
+'- A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop-N - 3'
 ===-2===
-’  K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 5’
+'- H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K -5'
 ===-3===
-’  K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 5’
+'- I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K -5'
 ==Open Reading Frames==
 +1, -2, -3 are all open reading frames
 ==Acknowledgements==
-I worked with my homework partner [User:arashlari|Arash Lari] on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
+I worked with my homework partner Arash Lari on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
 ==References==
 LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_1

← Older revision		Revision as of 04:57, 12 September 2017
Line 19:		Line 19:
	==Open Reading Frames==		==Open Reading Frames==
	+1, -2, -3 are all open reading frames		+1, -2, -3 are all open reading frames
		+	==Acknowledgements==
		+	I worked with my homework partner [User:arashlari\|Arash Lari] on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
		+	==References==
		+	LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_1
		+	==Links==
		+	{{template:dbashour}}
		+
		+	[[Category: Journal Entry]]

@@ Line 1: / Line 1: @@
-DNA strand
+==DNA==
 ’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
-Contemporary DNA Strand
+===Contemporary DNA Strand===
 '-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'