Emmatyrnauer Week 2 - Revision history

Emmatyrnauer: adding category journal entry

2017-09-20T04:32:33Z

adding category journal entry

2017-09-13T16:16:27Z

‎3 reading frames read 5' to 3' on the mRNA (-1, -2, -3): replacing 5' and 3' with N and C Terminus

2017-09-13T16:15:23Z

‎3 reading frames read 5' to 3' on the mRNA (+1,+2, +3): replacing 5' and 3' ends with N and C terminus

2017-09-12T02:19:01Z

syntax

2017-09-12T02:16:11Z

fixing syntax

2017-09-11T06:09:51Z

Acknowledgements and References added

2017-09-11T05:59:57Z

labeling open reading frame

2017-09-11T05:58:08Z

replacing three letter abbreviation with one letter

2017-09-11T05:39:54Z

‎3 reading frames read 5' to 3' on the mRNA

2017-09-11T05:39:23Z

‎3 reading frames read 5' to 3' on the mRNA

← Older revision		Revision as of 04:32, 20 September 2017
Line 25:		Line 25:
	==References==		==References==
	LMU BioDB 2017. (2017). Week 2. Retrieved September 10, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2		LMU BioDB 2017. (2017). Week 2. Retrieved September 10, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
		+
		+	[[Category:Journal Entry]]

@@ Line 15: / Line 15: @@
 '- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
 =====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)=====
-  *5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3' (open reading frame)
+  *N Ter- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -C Ter (open reading frame)
-  *5'- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F -3'
+  *N Ter- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F -C Ter
-  *3'- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F -3'
+  *N Ter- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F -C Ter
 ==Acknowledgments==

@@ Line 6: / Line 6: @@
 '- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
 =====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)=====
-  *5'- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T -3'
+  *N Ter- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T -C Ter
-  *5'- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I -3' (open reading frame)
+  *N Ter- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I -C Ter (open reading frame)
-  *5'- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y -3' (open reading frame)
+  *N Ter- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y -C Ter (open reading frame)
 ===Complementary strand===

@@ Line 6: / Line 6: @@
 '- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
 =====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)=====
-*stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T
+ *5'- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T -3'
-*K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame)
+ *5'- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I -3' (open reading frame)
-*K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame)
+ *5'- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y -3' (open reading frame)
 ===Complementary strand===
@@ Line 15: / Line 15: @@
 '- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
 =====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)=====
-  *R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame)
+  *5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3' (open reading frame)
-  *V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F
+  *5'- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F -3'
-  *Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F
+  *3'- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F -3'
 ==Acknowledgments==

@@ Line 2: / Line 2: @@
 ==Week 2 Individual Assignment==
 ===Strand Provided===
 '- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’
 ====mRNA synthesized from this strand====
 '- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
 =====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)=====
 *stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T
@@ Line 11: / Line 11: @@
 ===Complementary strand===
 ’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’
 ====mRNA synthesized from this strand====
 '- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
 =====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)=====
-*R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame)
+ *R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame)
-*V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F
+ *V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F
-*Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F
+ *Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F
 ==Acknowledgments==

@@ Line 12: / Line 12: @@
 ===mRNA synthesized from this strand===
 '- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
-====3 reading frames read 5' to 3' on the mRNA====
+====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)====
 *arg-met-leu-ile-pro-cys-ser-ala-tyr-asn-pro-ala-ala-ser-ser-ala-gly-glt-ile-leu
 *val-cys-stop-tyr-his-val-pro-arg-ile-thr-gln-pro-pro-val-pro-leu-ala-ala-phe
 *tyr-ala-asn-thr-met-phe-arg-val-stop-pro-ser-arg-gln-phe-arg-trp-arg-his-phe