Emmatyrnauer Week 3 - Revision history

Emmatyrnauer: adding category journal entry

2017-09-20T04:33:45Z

adding category journal entry

Emmatyrnauer: /* References */ adding another reference

2017-09-20T04:25:30Z

‎References: adding another reference

Emmatyrnauer: /* Acknowledgements */ added location i used to hack

2017-09-20T04:13:45Z

‎Acknowledgements: added location i used to hack

Emmatyrnauer: /* Studying the curled code */ answering questions

2017-09-20T04:07:23Z

‎Studying the curled code: answering questions

Emmatyrnauer: /* References */ adding week 3 assignment page as reference

2017-09-20T02:30:24Z

‎References: adding week 3 assignment page as reference

Emmatyrnauer: /* Notebook */ adding to notebook

2017-09-18T21:02:45Z

‎Notebook: adding to notebook

Emmatyrnauer: /* Notebook */ adding material to notebook section

2017-09-18T19:47:34Z

‎Notebook: adding material to notebook section

Emmatyrnauer: /* Acknowledgements */ adding to acknowledgments

2017-09-18T19:03:13Z

‎Acknowledgements: adding to acknowledgments

Emmatyrnauer: adding acknowledgments and references headers

2017-09-18T18:46:39Z

adding acknowledgments and references headers

Emmatyrnauer: /* The Genetic Code by Way of the Web */ adding questions and starting the notebook

2017-09-18T18:37:27Z

‎The Genetic Code by Way of the Web: adding questions and starting the notebook

← Older revision		Revision as of 04:33, 20 September 2017
Line 47:		Line 47:
	#Wikipedia:Picture tutorial. Retrieved September 18, 2017, from https://en.wikipedia.org/wiki/Wikipedia:Picture_tutorial		#Wikipedia:Picture tutorial. Retrieved September 18, 2017, from https://en.wikipedia.org/wiki/Wikipedia:Picture_tutorial
	#LMU BioDB 2017. (2017). Week 3. Retrieved September 18, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3		#LMU BioDB 2017. (2017). Week 3. Retrieved September 18, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3
		+
		+	[[Category:Journal Entry]]

← Older revision		Revision as of 04:25, 20 September 2017
Line 45:		Line 45:

	==References==		==References==
−	LMU BioDB 2017. (2017). Week 3. Retrieved September 18, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3	+	#Wikipedia:Picture tutorial. Retrieved September 18, 2017, from https://en.wikipedia.org/wiki/Wikipedia:Picture_tutorial
		+	#LMU BioDB 2017. (2017). Week 3. Retrieved September 18, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3

@@ Line 40: / Line 40: @@
 ==Acknowledgements==
 #I worked with my homework partner [[User:Zvanysse|Zachary Van Ysseldyk]] outside of class. We met up and he helped me understand the curl command and how to do the individual assignment.
 #While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
 [[User:Emmatyrnauer|Emmatyrnauer]] ([[User talk:Emmatyrnauer|talk]]) 12:03, 18 September 2017 (PDT)

@@ Line 19: / Line 19: @@
 ===Studying the curled code===
-#Are there any links to other pages within the ExPASy translation server’s responses? List them and state where they go. (of course, if you aren’t sure, you can always go there with a web browser or curl)
+Are there any links to other pages within the ExPASy translation server’s responses? List them and state where they go. (of course, if you aren’t sure, you can always go there with a web browser or curl)
-#*
-#Are there any identifiers in the ExPASy translation server’s responses? List them and state what you think they identify.
+ sib.css | website display
-#*
+ bas.css | website display
 ===Using the Command Line to Extract Just the Answers===
   curl -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa | sed "1,47d" | sed "14,44d" | sed 's/<[^>]*>//g' | sed "2s/[A-Z]/& /g" | sed "4s/[A-Z]/& /g" | sed "6s/[A-Z]/& /g" | sed "8s/[A-Z]/& /g" | sed "10s/[A-Z]/& /g" | sed "12s/[A-Z]/& /g" | sed "s/M/Met/g"| sed "s/-/Stop /g"

← Older revision		Revision as of 02:30, 20 September 2017
Line 35:		Line 35:

	==References==		==References==
		+	LMU BioDB 2017. (2017). Week 3. Retrieved September 18, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3

@@ Line 27: / Line 27: @@
 ===Notebook===
-In DMing the server with curl, I used the curl -d function to copy how the website performs the transcription process and used "pre_text=" from the the developer tools before the DNA sequence since that is the code that was used on ExPASy where the input goes. Zachary showed me how to use "&submit=Submit" at the end of the command. In extracting just the information needed, I used the sed command to get rid of the information before and after the mRNA that was produced from the initial command. The sed command was then used to replace all of the material between <> with nothing, and to put spaces between each of the amino acid abbreviations. Finally, the sed command was used to replace "M" with "Met" and "s" with "Stop."
+In DMing the server with curl, I used the curl -d function to copy how the website performs the transcription process and used "pre_text=" from the the developer tools before the DNA sequence since that is the code that was used on ExPASy where the input goes. Zachary showed me how to use "&submit=Submit" at the end of the command, and all of this was followed by the action on the ExPASy developer tools. In extracting just the information needed, I used the sed command to get rid of the information before and after the mRNA that was produced from the initial command. The sed command was then used to replace all of the material between <> with nothing, and to put spaces between each of the amino acid abbreviations. Finally, the sed command was used to replace "M" with "Met" and "s" with "Stop."
 ==Acknowledgements==

← Older revision		Revision as of 19:03, 18 September 2017
Line 30:		Line 30:

	==Acknowledgements==		==Acknowledgements==
		+	#I worked with my homework partner [[User:Zvanysse\|Zachary Van Ysseldyk]] outside of class. We met up and he helped me understand the curl command and how to do the individual assignment.
		+	#While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
		+	[[User:Emmatyrnauer\|Emmatyrnauer]] ([[User talk:Emmatyrnauer\|talk]]) 12:03, 18 September 2017 (PDT)

	==References==		==References==

← Older revision		Revision as of 18:46, 18 September 2017
Line 28:		Line 28:
	===Notebook===		===Notebook===
	In DMing the server with curl,		In DMing the server with curl,
		+
		+	==Acknowledgements==
		+
		+	==References==